Linking bacterial symbiont physiology to the ecology of hydrothermal vent symbioses A dissertation presented by Roxanne Abra Beinart to The Department of Organismic and Evolutionary Biology in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the subject of Biology Harvard University Cambridge, Massachusetts November 2013

©2013 – Roxanne Abra Beinart All rights reserved

Dissertation advisor: Peter R. Girguis

Roxanne Abra Beinart

Linking bacterial symbiont physiology to the ecology of hydrothermal vent symbioses Symbioses between prokaryotes and eukaryotes are ubiquitous in our biosphere, nevertheless, the effects of such associations on the partners’ ecology and evolution are poorly understood. At hydrothermal vents, dominant invertebrate species typically host bacterial symbionts, which use chemical energy to fix carbon to nourish their hosts and themselves. In this dissertation, I present evidence that symbiont metabolism plays a substantive, if not major, role in habitat use by vent symbioses. A study of nearly 300 individuals of the symbiotic snail Alviniconcha sp. showed specificity between three host species and three specific symbiont phylotypes, as well as a novel lineage of Oceanospirillales. Additionally, this study revealed a structured distribution of each Alviniconcha-symbiont combination across ~300 km of hydrothermal vents that exhibited a gradient in geochemical composition, which is consistent with the physiological tendencies of the specific symbiont phylotypes. I also present a comparison of the in situ gene expression of the symbionts of Alviniconcha across that same geochemical gradient, which further implicates symbiont energy and nitrogen metabolism in governing the habitat partitioning of Alviniconcha. Finally, I present data that allies productivity and sulfur metabolism in three coexisting vent symbioses, demonstrating specific interaction with the environment. Three symbioses, namely the snails Alviniconcha and Ifremeria, and the mussel Bathymodiolus, are found around vents with differing concentrations of sulfide, thiosulfate and polysulfide. Using high-pressure, flow-through incubations and stable isotopic tracers, I quantified symbiont productivity via sulfide and thiosulfate oxidation, and provided the first demonstration of thiosulfate-dependent autotrophy in intact hydrothermal vent symbioses. I further demonstrated that vent symbioses can excrete

!

iii

thiosulfate and/or polysulfides, implicating them in substantively influencing the sulfur chemistry of their habitats. In summary, this dissertation demonstrates the importance of symbiont physiology to the ecology of prokaryote-eukaryote symbioses by revealing that symbiont activity may be critically important to the distribution of symbioses among specific niches, as well as can alter the geochemical environment through uptake and excretion of chemicals.

!

iv

Linking bacterial symbiont physiology to the ecology of hydrothermal vent symbioses

Table of Contents Acknowledgements Chapter 1 Introduction vi 1

Chapter 2 15 Evidence for the role of endosymbionts in regional-scale habitat partitioning by hydrothermal vent symbioses Chapter 3 24 Metatranscriptomics reveal differences in in situ energy and nitrogen metabolism among hydrothermal vent snail symbionts Chapter 4 The uptake and excretion of partially oxidized sulfur broadens our understanding of the energy resources metabolized by hydrothermal vent symbioses 37

Chapter 5 74 Intracellular Oceanospirillales among the chemosynthetic symbionts of the hydrothermal vent snail Alviniconcha: secondary symbionts or parasites? Appendix 1 Chapter 2 Supplemental Material Appendix 2 Chapter 3 Supplemental Material Appendix 3 Chapter 4 Supplemental Material Appendix 4 Chapter 5 Supplemental Material 95 101 109 114

!

v

Acknowledgements All that I have accomplished as a PhD student was made possible with the help and support of amazing people, both in my professional and personal life. I will always be beyond grateful to my advisor, Peter Girguis, for the faith he had in me from the very beginning, his continued patience and attention throughout my time in graduate school, and above all else, the fact that that he always treated me as a peer. The scope of skills I learned in the Girguis lab is beyond what I ever predicted I would as a graduate student: from wiring an outlet to identifying a pipe-fitting to writing a proposal. I am thankful for all that I have learned from Pete, and I know that I will only appreciate these things more as I move forward into other research. I also thank my committee, Andrew Knoll, Colleen Cavanaugh and Christopher Marx ; their questions were always balanced by encouragement and my dissertation is inestimably better because of their input and help. I must also express gratitude to the past and current members of the Girguis lab, as well as others in the department of Organismic and Evolutionary Biology. I have been so fortunate to be part of such a supportive and inspiring lab group; I now can’t imagine preparing a talk without their invaluable insight and direction. I must especially thank Jon Sanders, who has contributed, in both large and small ways, to every project I have worked on during my dissertation; I am lucky to have found both a friend and colleague in Jon. And of course there are my labmates, officemates, friends, and, at least in Kiana’s case, roommate, Kiana Frank and Heather Olins; as well as my friend and lab neighbor, Dipti Nayak. They always challenged and supported me, and made every day fun. I am grateful for their friendship, which I know will be life-long. Thank you to the many, many collaborators and coauthors that I have worked with as a graduate student. The list is long, but special thanks to Charles Fisher, Erin Becker, George !
vi

Luther, Amy Gartman, Nicole Dubilier, Spencer Nyholm, and Frank Stewart. Additionally, this work could have been done without the crew of the R/V Thomas G. Thompson and the ROV JASON II. I am also grateful to the staff of the Ernst Mayr Library of the Museum of Comparative Zoology at Harvard University for their acquisition of countless obscure articles and books for me. And in terms of logistical and moral support, I am particularly indebted to Jennifer Delaney and Stephanie Hillsgrove, who made lab logistical and administrative tasks immeasurably easier. I am so appreciative of the incredible friends and family that I have encouraging me behind the scenes. Thank you to my extended family June and Steve Jones, Dana Jones, Erin Cooper, Jordan Kunkes and Eve Boltax for their love and support. My old friends Kara Gaughen, Jessica Russell, Alicia Widge, Laurel Aquadro and Christine Sun brighten my life in so many ways and nobody makes me laugh as hard. My husband Andy Jones has been an inspiration; I admire him for his unending optimism and constant curiosity. I am so grateful for our partnership and could not have done this without him. Thank you to my sister Nina Kunkes, whose wit and focus I admire, and whose love and support has been unwavering. And finally, thank you to my parents, Daniel and Phyllis Beinart. My father always encouraged my scientific interests, whether he was teaching me binary code at the kitchen table or driving me to a before-school lab class in fourth grade. He gave me the skeptical, analytical mind that makes science fun. My mother is my greatest cheerleader, and never fails to make me feel like my work is important. She is why I strive to go as far as I can as a woman in this field, and make the path easier for those coming after me. I will always be grateful, for they are the reason I have made it this far.

!

vii

Chapter 1 Introduction

There is a growing appreciation for the ubiquity of microbial symbioses on Earth, yet for most of these we only have a basic understanding of symbiont physiology and the impact of these partnerships on ecosystem ecology and biogeochemistry. Eukaryotes in many ecosystems have evolved specific associations with prokaryotes that allow them to capitalize on the relative diversity of prokaryotic metabolisms. Via the metabolic activities of their symbionts, host eukaryotes stand to gain a number of benefits including: access to novel nutritional or energy resources, detoxification of their surroundings, and/or metabolic processes that facilitate or complement their own metabolism. Thus, symbionts have the potential to mediate an organism’s interaction with its biotic and abiotic environment. For example, symbiont physiology has the potential to influence the association’s use of a specific habitat (Tsuchida et al. 2004), to affect interactions with predators (Lopanik et al. 2004), or, through metabolic activity, to alter local biogeochemical cycles (van der Heide et al. 2012). Despite the potential significance of their activities on ecosystems, we have characterized the interaction between symbiont physiology and habitat in relatively few symbiotic taxa. This is particularly startling when we consider the prevalence of prokaryote-eukaryote symbioses in many environments, particularly in some marine ecosystems. To this end, the thesis presented here advances our understanding of the functioning of bacterial-animal symbioses at deep-sea, hydrothermal vent ecosystems through surveys characterizing the abundance and distribution of both symbiont and host in differing habitats (Ch.2 & 4), interrogation of symbiont physiological poise via transcriptomic analysis (Ch.3), and direct experimental measurement of symbiont metabolism (Ch.5). Mutualistic associations between prokaryotes and eukaryotes predominate at hydrothermal vent habitats (Fisher et al. 2007). At these deep-sea hotsprings, invertebrates from many phyla have evolved partnerships with bacteria that enable them to thrive in the typically !
2

resource-limited deep ocean (Dubilier et al. 2008; Cavanaugh et al. 2006). Symbiosis with bacteria allows animals to access chemical energy in venting fluid, which is otherwise unavailable to them as eukaryotes. Hydrothermal fluid is enriched in reduced substrates such as sulfide, methane and hydrogen that can be oxidized by chemoautotrophic bacteria providing energy for carbon fixation (Tsuchida et al. 2004; Tivey 2007). Through partnerships with chemoautotrophs, many vent invertebrates indirectly access this process, which ultimately provides the bulk of their nutrition (Lopanik et al. 2004; Cavanaugh et al. 1981; Fisher et al. 1989; Felbeck 1981; Belkin et al. 1986; Nelson et al. 1995; Polz et al. 1998; Ponsard et al. 2012; Watsuji et al. 2012). At almost all hydrothermal vents explored to date, dense assemblages of host animals are found clustered around vent orifices in order to provide their symbionts access to chemicals in venting fluid (van der Heide et al. 2012; Stewart et al. 2005). Despite this common need for contact with vent fluid, their structured distribution within and among vent fields suggests habitat specialization by the holobionts (i.e., host and symbiont together). Vents are well-known for their variability in physico-chemical characteristics at both of these scales (Fisher et al. 2007; Le Bris et al. 2000; Mottl et al. 2011; Butterfield et al. 1994), providing a wealth of habitats that would enable regional or local environmental sorting. Indeed, differences in symbiotic communities are often observed among vent fields within the same region that have differing chemistry or geology (Dubilier et al. 2008; Desbruyeres et al. 2000; Cavanaugh et al. 2006; Galkin 1997; Desbruyeres et al. 1994). Additionally, within a vent field, vent holobionts are often found in discrete, mono-specific or –generic zones or patches that are associated with particular physico-chemical features (Marsh et al. 2012; Podowski et al. 2010; Luther et al. 2001; Waite et al. 2008; Cuvelier et al. 2011; Sarrazin et al. 1997; Tokeshi 2011; Sarrazin et al. 2002; Sarrazin & Juniper 1999). Typically, these patterns have been attributed to interactions between the environment and host physiology or traits – for example, differences in !
3

tolerance to temperature or sulfide – that would lead to niche specialization (Podowski et al. 2010; Luther et al. 2001; Waite et al. 2008; Cuvelier et al. 2011; Sarrazin et al. 1997). However, it is equally likely that symbiont traits influence habitat specialization in these organisms, with the potential to drive the observed environmental sorting. Because most host taxa specifically associate with only one or two lineages of symbiont (Dubilier et al. 2008; Cavanaugh et al. 2006), the attributes of their particular partners may determine the niche of the holobiont. In addition to affecting host ecology, the activities of chemoautotrophic vent symbionts may have a significant impact on their abiotic environment. Given the density of symbionts in host tissue, symbiont population sizes may rival or exceed those of similar free-living prokaryotes in their environment (Yamamoto et al. 2002; Pranal et al. 2009; Belkin et al. 1986; Powell & Somero 1986); therefore, symbiont metabolism has the potential to drastically influence local geochemistry. In situ manipulations that have measured the water chemistry before and after removal of vent symbioses have shown that they significantly deplete the reductants in venting fluid (Podowski et al. 2010; Waite et al. 2008; Le Bris et al. 2006). This has been reinforced with experimental measurements of the rates of sulfur, methane and hydrogen oxidation by a few intact symbioses and physically isolated symbionts (Girguis & Childress 2006; Henry et al. 2008; Childress et al. 1991; Petersen et al. 2011; Fisher et al. 1987; Wilmot & Vetter 1990; Goffredi et al. 1997). Input of metabolic end-products by vent symbioses into the environment is less wellcharacterized than their utilization of vent fluid reductants. Hydrogen sulfide oxidation by the symbionts of vent tubeworms has been shown to lower the pH of the surrounding water through the excretion of hydrogen ions (Girguis et al. 2002). In addition, in vitro experiments on symbionts show that some might only partially oxidize sulfide, excreting the resulting partially oxidized sulfur (Wilmot & Vetter 1990). Since insight into the ecology of vent symbioses and their effect on the environment is bound to our understanding of symbiont activity, more work is !
4

needed to characterize the range of symbiont metabolism. Among the symbionts of vent animals, high phylogenetic diversity, as well as widespread horizontal gene transfer, likely corresponds to ecologically significant physiological diversity (Kleiner et al. 2012). Vent symbionts are derived from many lineages of Proteobacteria, mainly γ-proteobacteria, that have independently evolved from various free-living lineages (Cavanaugh et al. 2006; Dubilier et al. 2008; Petersen et al. 2012). Though they converge in basic chemoautotrophic function, they can diverge in biochemical pathways or entire metabolisms that may have ecological implications for the host with which they associate. A comparison of the genomic content among some of the γ-proteobacterial symbionts of vent animals has shown that they can differ in genes for energy metabolism, carbon fixation and nitrogen acquisition (Kleiner et al. 2012). Moreover, experiments comparing the metabolism of vent symbioses have shown that they can differ in their use of substrates like sulfur compounds (Belkin et al. 1986; Wilmot & Vetter 1990). Whether and how these differences translate into niche preference by the holobionts is still unknown, but these characteristics potentially affect their distribution. In addition, differences among symbiont metabolism have the potential to differentially affect local geochemistry. The work comprising this thesis focuses on the diverse chemoautotrophic symbionts of three mollusc genera found in dense communities at vents along the Eastern Lau Spreading Center (ELSC), which is part of the Lau back-arc basin. The ELSC comprises a series of vent fields that are found fairly linearly along a north-south spreading center, separated by 10s to 100s of kilometers. Vents along the ELSC span geological and geochemical gradients that result from the increasing influence of the subducting Pacific plate on crustal composition in the southward direction (Tivey et al. 2012). Vents in the northern part of the Lau Basin are mainly basaltic, while those in the south primarily andesitic. This geological shift has been linked to a north-south !
5

gradient in vent fluid geochemistry, as well as concurrent changes in vent biological communities (Podowski et al. 2010; Kim & Hammerstrom 2012). Because the ELSC vent fields are located in relative proximity to one another, span a gradient in physico-chemical conditions, and have no known barriers to biological dispersal (Speer & Thurnherr 2012), this region presented an ideal opportunity to investigate interactions between habitat and the ecology of vent symbioses. At ELSC vents, as well as others in the southwestern Pacific, two symbiotic provannid snail genera (Ifremeria and Alviniconcha), as well as the symbiotic mussel Bathymodiolus brevior, predominate (Podowski et al. 2009; Podowski et al. 2010; Desbruyeres et al. 1994). The genus Ifremeria is monotypic, containing only the species I. nautilei, while Alviniconcha comprises at least six cryptic lineages that were recently described as species (S. Johnson & B. Vrijenhoek, pers. comm.). In this dissertation, I discovered that three of the Alviniconcha host types (now thought to be species) co-occur at the ELSC vents (Ch.1). In Chapter 2, I surveyed the distribution of Alviniconcha host and symbiont types at vents along the ELSC, linking observed changes in geochemistry to a structured distribution of host-symbiont associations. Subsequent investigation of symbiont physiological poise through transcriptomic sequencing allowed me to assess the in situ gene expression of Alviniconcha symbionts from across the geochemical gradient (Ch. 3). In addition, my survey of the diversity of ELSC Alviniconcha symbionts and quantitative assessment of their association with the three host species, revealed an additional bacterial inhabitant of some Alviniconcha types which could be ecologically important via metabolic interactions with the symbioses or as a parasite (Ch.4). On a much smaller spatial scale, observed patterns in intra-field habitat differentiation by the symbiotic molluscs of the ELSC suggest specific interactions and chemical exchanges with the abiotic environment. Surveys of the animal assemblages at ELSC vents have shown that these genera predictably occur in zones around hydrothermal vent flows with Alviniconcha nearest to the !
6

vent orifice, Ifremeria comprising the next zone, and B. brevior being found at the very edges (Waite et al. 2008; Podowski et al. 2009; Podowski et al. 2010). For these holobionts, energy resources are directly tied to the physical space they occupy. As vent fluid emerges from the crust, it can be quickly diluted by the surrounding seawater and/or oxidized, either abiotically by reacting with metals or through the activities of free-living microorganisms (Santos Afonso & Stumm 1992; Pyzik & Sommer 1981; Luther et al. 2011; Gartman et al. 2011). Accordingly, proximity to the fluid flow is essential for productivity in these symbioses, since chemical reductants may quickly disappear. However, their need for fluid exposure is balanced by their tolerances to heat and/or toxic chemicals found in venting fluid, as well as by competitive interactions among the holobionts. At the ELSC, both these abiotic and biological processes are thought to shape the zonation of the three symbiotic mollusc genera (Sen et al. 2013; Podowski et al. 2010). However, at the ELSC vents, another factor may enable the observed community structure. In this region, vent symbionts are hypothesized to supplement chemoautotrophy based on the highly-reduced chemicals from the venting fluid with the use of partially oxidized sulfur, which is reasonably abundant in the seawater around the symbiotic animals (Waite et al. 2008; Mullaugh et al. 2008; Gartman et al. 2011). For example, though undetectable amounts of sulfide are often found around B. brevior, concentrations of the partially oxidized compound thiosulfate are often high (Mullaugh et al. 2008; Waite et al. 2008). If low tolerance to high temperatures or sulfide concentrations or competitive exclusion by the other symbioses prevents B. brevior from inhabiting areas of high fluid flow, thiosulfate has the potential to serve as an important energy source. To address whether this is the case, in Chapter 5, I used high-pressure, flow-through respirometry to directly test the ability of all three ELSC molluscs to fuel autotrophy with the oxidation of thiosulfate. In addition, because the source of partially oxidized sulfur in situ is unknown, I measured the excretion of sulfur compounds by the three symbioses !
7

when provided different sulfur substrates. The results of these experiments yield important insights into the chemoautotrophic metabolism of hydrothermal vent organisms and their potential to influence the pool of reductants in their habitats through excretion. This dissertation demonstrates the importance of symbiont physiology to the ecology of prokaryote-eukaryote symbioses. Though the effects of symbiont activity on organismal ecology may be readily apparent at symbioses-dominated ecosystems like hydrothermal vents, given the prevalence of prokaryote-eukaryote symbioses on earth, they are likely to be significant in other biological systems as well. Here, I underscore that the activities of microbial symbionts may be imperative to a) the distribution of symbioses into specific niches and b) exchange with the geochemical environment through uptake and excretion of chemicals. In sum, my efforts advance our understanding of the fundamental influence of symbiont activity on hydrothermal vent ecosystem processes, providing valuable insight into the physiology of chemoautotrophic symbionts and their effects on host ecology and local geochemistry.

!

8

References Belkin, S., Nelson, D.C. & Jannasch, H.W., 1986. Symbiotic assimilation of CO2 in the two hydrothermal vent animals, the mussel Bathymodiolus thermophilus and the tubeworm Riftia pachyptila. Biol Bull, 170(1), pp.110–121. Butterfield, D.A. et al., 1994. Gradients in the composition of hydrothermal fluids from the Endeavour segment vent field: Phase separation and brine loss. J. Geophys. Res., 99(B5), pp.9561–9583. Cavanaugh, C. et al., 2006. Marine Chemosynthetic Symbioses. In The Prokaryotes. pp. 475– 507. Cavanaugh, C.M. et al., 1981. Prokaryotic Cells in the Hydrothermal Vent Tube Worm Riftia pachyptila Jones: Possible Chemoautotrophic Symbionts. Science, 213, pp.340–342. Childress, J.J. et al., 1991. Sulfide and Carbon Dioxide Uptake by the Hydrothermal Vent Clam, Calyptogena magnifica, and Its Chemoautotrophic Symbionts. Physiological Zoology, 64(6), pp.1444–1470. Cuvelier, D. et al., 2011. Hydrothermal faunal assemblages and habitat characterisation at the Eiffel Tower edifice (Lucky Strike, Mid-Atlantic Ridge). Marine Ecology, 32(2), pp.243–255. Desbruyeres, D. et al., 2000. A review of the distribution of hydrothermal vent communities along the northern Mid-Atlantic Ridge: dispersal vs. environmental controls. Hydrobiologia, 440(1), pp.201–216. Desbruyeres, D. et al., 1994. Deep-sea hydrothermal communities in southwestern Pacific backarc basins (The North Fiji and Lau Basins) - composition, microdistribution and food-web. Marine Geology, 116(1-2), pp.227–242. Dubilier, N., Bergin, C. & Lott, C., 2008. Symbiotic diversity in marine animals: the art of harnessing chemosynthesis. Nat Rev Micro, 6(10), pp.725–740. Felbeck, H., 1981. Chemoautotrophic Potential of the Hydrothermal Vent Tube Worm, Riftia pachyptila Jones (Vestimentifera). Science (New York, N.Y.), 213(4505), pp.336–338. Fisher, C.R. et al., 1987. The importance of methane and thiosulfate in the metabolism of the bacterial symbionts of two deep-sea mussels. Marine Biology, 96(1), pp.59–71. Fisher, C.R., Childress, J.J. & Minnich, E., 1989. Autotrophic Carbon Fixation by the Chemoautotrophic Symbionts of Riftia pachyptila. Biol Bull, 177(3), pp.372–385. Fisher, C.R., Takai, K. & Le Bris, N., 2007. Hydrothermal vent ecosystems. Oceanography, 20(1), pp.14–23. Galkin, S.V., 1997. Megafauna associated with hydrothermal vents in the Manus Back-Arc Basin (Bismarck Sea). Marine Geology, 142(1-4), pp.197-206

!

9

Gartman, A. et al., 2011. Sulfide Oxidation across Diffuse Flow Zones of Hydrothermal Vents. Aquatic Geochemistry, 17(4-5), pp.583–601. Girguis, P.R. & Childress, J.J., 2006. Metabolite uptake, stoichiometry and chemoautotrophic function of the hydrothermal vent tubeworm Riftia pachyptila: responses to environmental variations in substrate concentrations and temperature. Journal of Experimental Biology, 209(18), pp.3516–3528. Girguis, P.R. et al., 2002. Effects of metabolite uptake on proton-equivalent elimination by two species of deep-sea vestimentiferan tubeworm, Riftia pachyptila and Lamellibrachia cf luymesi: proton elimination is a necessary adaptation to sulfide-oxidizing chemoautotrophic symbionts. Journal of Experimental Biology, 205(19), pp.3055–3066. Goffredi, S. et al., 1997. Sulfide acquisition by the vent worm Riftia pachyptila appears to be via uptake of HS-, rather than H2S. J Exp Biol, 200(20), pp.2609–2616. Henry, M.S., Childress, J.J. & Figueroa, D., 2008. Metabolic rates and thermal tolerances of chemoautotrophic symbioses from Lau Basin hydrothermal vents and their implications for species distributions. Deep Sea Research Part I: Oceanographic Research Papers, 55(5), pp.679–695. Kim, S. & Hammerstrom, K., 2012. Hydrothermal vent community zonation along environmental gradients at the Lau back-arc spreading center. Deep Sea Research Part I: Oceanographic Research Papers, 62(0), pp.10–19. Kleiner, M., Petersen, J.M. & Dubilier, N., 2012. Convergent and divergent evolution of metabolism in sulfur-oxidizing symbionts and the role of horizontal gene transfer. Current Opinion in Microbiology, 15(5), pp.621–631. Le Bris, N. et al., 2000. A new chemical analyzer for in situ measurement of nitrate and total sulfide over hydrothermal vent biological communities. Marine Chemistry, 72(1), pp.1-15 Le Bris, N. et al., 2006. Variability of physico-chemical conditions in 9 50′ N EPR diffuse flow vent habitats. Marine Chemistry, 98, pp.167-182 Lopanik, N., Gustafson, K.R. & Lindquist, N., 2004. Structure of Bryostatin 20: A SymbiontProduced Chemical Defense for Larvae of the Host Bryozoan, Bugulaneritina. Journal of Natural Products, 67(8), pp.1412–1414. Luther, G.W. et al., 2011. Thermodynamics and kinetics of sulfide oxidation by oxygen: a look at inorganically controlled reactions and biologically mediated processes in the environment. Frontiers in microbiology, 2, p.62. Luther, G.W., III et al., 2001. Chemical speciation drives hydrothermal vent ecology. Nature, 410, p.813. Marsh, L. et al., 2012. Microdistribution of Faunal Assemblages at Deep-Sea Hydrothermal Vents in the Southern Ocean H. Browman, ed. PLoS ONE, 7(10), p.e48348.

!

10

Mottl, M.J. et al., 2011. Chemistry of hot springs along the Eastern Lau Spreading Center. Geochimica Et Cosmochimica Acta, 75, pp.1013–1038. Mullaugh, K.M. et al., 2008. Voltammetric (Micro)Electrodes for the In Situ Study of Fe2+ Oxidation Kinetics in Hot Springs and S2O Production at Hydrothermal Vents. Electroanalysis, 20(3), pp.280–290. Nelson, D.C., Hagen, K.D. & Edwards, D.B., 1995. The gill symbiont of the hydrothermal vent mussel Bathymodiolus thermophilus is a psychrophilic, chemoautotrophic, sulfur bacterium. Marine Biology, 121(3), pp.487–495. Petersen, J.M. et al., 2011. Hydrogen is an energy source for hydrothermal vent symbioses. Nature, 476(7359), pp.176–180. Petersen, J.M. et al., 2012. Origins and evolutionary flexibility of chemosynthetic symbionts from deep-sea animals. Biol Bull, 223(1), pp.123–137. Podowski, E.L. et al., 2010. Biotic and abiotic factors affecting distributions of megafauna in diffuse flow on andesite and basalt along the Eastern Lau Spreading Center, Tonga. Marine Ecology Progress Series, 418, pp.25–45. Podowski, E.L. et al., 2009. Distribution of diffuse flow megafauna in two sites on the Eastern Lau Spreading Center, Tonga. Deep-Sea Research Part I, 56(11), pp.2041–2056. Polz, M.F. et al., 1998. Trophic ecology of massive shrimp aggregations at a Mid-Atlantic Ridge hydrothermal vent site. Limnology and Oceanography, 43(7), pp.1631–1638. Ponsard, J. et al., 2012. Inorganic carbon fixation by chemosynthetic ectosymbionts and nutritional transfers to the hydrothermal vent host-shrimp Rimicaris exoculata. The ISME journal, 7(1), pp.96–109. Powell, M.A. & Somero, G.N., 1986. Adaptations to Sulfide by Hydrothermal Vent Animals Sites and Mechanisms of Detoxification and Metabolism. Biological Bulletin, 171(1), pp.274– 290. Pranal, V., Fiala-Medioni, A. & Guezennec, J., 2009. Fatty acid characteristics in two symbiontbearing mussels from deep-sea hydrothermal vents of the south-western Pacific. Journal of the Marine Biological Association of the UK, 77(02), pp.473–492. Pyzik, A.J. & Sommer, S.E., 1981. Sedimentary iron monosulfides: Kinetics and mechanism of formation. Geochimica Et Cosmochimica Acta, 45(5), pp.687-698 Santos Afonso, Dos, M. & Stumm, W., 1992. Reductive dissolution of iron (III)(hydr) oxides by hydrogen sulfide. Langmuir, 8(6), pp.1671-1675 Sarrazin, J. & Juniper, S.K., 1999. Biological characteristics of a hydrothermal edifice mosaic community. Marine Ecology Progress Series, 185, pp.1-19

!

11

Sarrazin, J., Levesque, C. & Juniper, S., 2002. Mosaic community dynamics on Juan de Fuca Ridge sulphide edifices: substratum, temperature and implications for trophic structure. CBM-Cahiers de Biologie Marine, 43, pp.279-275 Sarrazin, J., Robigou, V. & Juniper, S.K., 1997. Biological and geological dynamics over four years on a high-temperature sulfide structure at the Juan de Fuca Ridge hydrothermal observatory. Marine Ecology Progress Series, 153, pp.5-24 Sen, A. et al., 2013. Distribution of mega fauna on sulfide edifices on the Eastern Lau Spreading Center and Valu Fa Ridge. Deep Sea Research Part I: Oceanographic Research Papers, 72, pp.48–60. Speer, K. & Thurnherr, A.M., 2012. The Lau Basin Float Experiment (LAUB-FLEX). Oceanography, 25(1), pp.284–285. Stewart, F.J.F., Newton, I.L.G.I. & Cavanaugh, C.M.C., 2005. Chemosynthetic endosymbioses: adaptations to oxic-anoxic interfaces. Trends in Microbiology, 13(9), pp.439–448. Tivey, M. et al., 2012. Links from Mantle to Microbe at the Lau Integrated Study Site: Insights from a Back-Arc Spreading Center. Oceanography, 25(1), pp.62–77. Tivey, M.K., 2007. Generation of Seafloor Hydrothermal Vent Fluids and Associated Mineral Deposits. Oceanography, 20(1), pp.50–65. Tokeshi, M., 2011. Spatial structures of hydrothermal vents and vent-associated megafauna in the back-arc basin system of the Okinawa Trough, western Pacific. Journal of Oceanography, 67(5), pp.651-665 Tsuchida, T., Koga, R. & Fukatsu, T., 2004. Host Plant Specialization Governed by Facultative Symbiont. Science, 303, pp.1989–1989. van der Heide, T. et al., 2012. A Three-Stage Symbiosis Forms the Foundation of Seagrass Ecosystems. Science, 336, pp.1432–1434. Waite, T.J. et al., 2008. Variation in sulfur speciation with shellfish presence at a Lau Basin diffuse flow vent site. Journal of Shellfish Research, 27(1), pp.163–168. Watsuji, T.-O. et al., 2012. Cell-Specific Thioautotrophic Productivity of Epsilon-Proteobacterial Epibionts Associated with Shinkaia crosnieri, PLoS ONE, 7(10), p.e46282. Wilmot, D.B., Jr & Vetter, R.D., 1990. The bacterial symbiont from the hydrothermal vent tubeworm Riftia pachyptila is a sulfide specialist. Marine Biology, 106(2), pp.273–283. Yamamoto, H. et al., 2002. Phylogenetic characterization and biomass estimation of bacterial endosymbionts associated with invertebrates dwelling in chemosynthetic communities of hydrothermal vent and cold seep fields. Marine Ecology Progress Series, 245, pp.61–67.

!

12

Chapter 2 Evidence for the role of endosymbionts in regional-scale habitat partitioning by hydrothermal vent symbioses

(as published in Proceedings of the National Academy of Sciences)

Evidence for the role of endosymbionts in regional-scale habitat partitioning by hydrothermal vent symbioses
Roxanne A. Beinarta, Jon G. Sandersa, Baptiste Faureb,c, Sean P. Sylvad, Raymond W. Leee, Erin L. Beckerb, Amy Gartmanf, George W. Luther IIIf, Jeffrey S. Seewaldd, Charles R. Fisherb, and Peter R. Girguisa,1
a Department of Organismic and Evolutionary Biology, Harvard University, Cambridge, MA 02138; bBiology Department, Pennsylvania State University, University Park, PA 16802; cInstitut de Recherche pour le Développement, Laboratoire d’Ecologie Marine, Université de la Réunion, 97715 Saint Denis de La Réunion, France; dDepartment of Marine Chemistry and Geochemistry, Woods Hole Oceanographic Institution, Woods Hole, MA 02543; eSchool of Biological Sciences, Washington State University, Pullman, WA 99164; and fSchool of Marine Science and Policy, University of Delaware, Lewes, DE 19958

Edited* by Paul G. Falkowski, Rutgers, The State University of New Jersey, New Brunswick, NJ, and approved September 26, 2012 (received for review February 21, 2012)

Deep-sea hydrothermal vents are populated by dense communities of animals that form symbiotic associations with chemolithoautotrophic bacteria. To date, our understanding of which factors govern the distribution of host/symbiont associations (or holobionts) in nature is limited, although host physiology often is invoked. In general, the role that symbionts play in habitat utilization by vent holobionts has not been thoroughly addressed. Here we present evidence for symbiont-influenced, regional-scale niche partitioning among symbiotic gastropods (genus Alviniconcha) in the Lau Basin. We extensively surveyed Alviniconcha holobionts from four vent fields using quantitative molecular approaches, coupled to characterization of high-temperature and diffuse vent-fluid composition using gastight samplers and in situ electrochemical analyses, respectively. Phylogenetic analyses exposed cryptic host and symbiont diversity, revealing three distinct host types and three different symbiont phylotypes (one ε-proteobacteria and two γ-proteobacteria) that formed specific associations with one another. Strikingly, we observed that holobionts with ε-proteobacterial symbionts were dominant at the northern fields, whereas holobionts with γ-proteobacterial symbionts were dominant in the southern fields. This pattern of distribution corresponds to differences in the vent geochemistry that result from deep subsurface geological and geothermal processes. We posit that the symbionts, likely through differences in chemolithoautotrophic metabolism, influence niche utilization among these holobionts. The data presented here represent evidence linking symbiont type to habitat partitioning among the chemosynthetic symbioses at hydrothermal vents and illustrate the coupling between subsurface geothermal processes and niche availability.
chemoautotrophy

| symbiosis | endosymbiosis

iche partitioning, the process wherein coexisting organisms occupy distinct niches, is thought to be essential in structuring many biological communities (1–3). Classic studies of ecological niche partitioning have focused on how the intrinsic traits of organisms allow them to occupy or use distinct habitats or resources (4, 5). However, species also can access novel niche space via symbiotic associations with other organisms. In these cases, the niche of the host is expanded through the addition of the symbiont’s physiological capabilities. With increasing awareness of the prevalence of microbe–animal associations, the effect of the symbiont(s) on niche utilization may prove to be key to understanding the coexistence of organisms in many biological communities. This effect is likely to be especially important in ecosystems structured by coexisting symbiotic associations, such as hydrothermal vents. Therefore, we looked for habitat-utilization patterns reflective of symbiont-influenced niche partitioning among a group of closely related snail–bacterial symbioses in the Eastern Lau Spreading Center (ELSC) hydrothermal vent system.
www.pnas.org/cgi/doi/10.1073/pnas.1202690109

N

Hydrothermal vents are extremely productive environments wherein primary production occurs via chemolithoautotrophy, the generation of energy for carbon fixation from the oxidation of vent-derived reduced inorganic chemicals (6). The dense communities of macrofauna that populate these habitats typically are dominated by invertebrates that form symbiotic associations with chemolithoautotrophic bacteria (7). In these chemosynthetic associations, the endosymbionts oxidize reduced vent-derived compounds—usually hydrogen sulfide (H2S)—and fix inorganic carbon, which is shared with their host for biosynthesis and growth (8–12). Symbiotic associations between chemolithoautotrophic bacteria and invertebrates have been described for multiple invertebrate taxa from three phyla (13), and these associations often coexist within given vent fields, systems of vent fields (regions), and biogeographic provinces (14). It is well established that hydrothermal fluid can exhibit marked spatial and temporal differences in temperature, pH, and chemical composition, the result of numerous subsurface geological, chemical, physical, and biological factors (15–18). This heterogeneity across both space and time provides myriad physicochemical niches and ample ecological opportunity to support a diversity of chemosynthetic symbioses via niche specialization. Previous studies have examined successional changes within a community of chemosynthetic symbioses in relation to temporal changes in vent-fluid chemistry (19, 20), the distribution of the symbioses in relation to physicochemical conditions within a vent field (21–27), and the distribution of chemosynthetic symbioses among different vent fields (28, 29). Host tolerance, growth rates, and physiological capacities often are invoked when explaining the observed distribution. Given the reliance of chemosynthetic symbioses on vent-derived chemicals for symbiont function (30), variations in symbiont physiological activity have the potential to result in distinct habitat-utilization patterns by holobionts. However, no study has yet comprehensively interrogated both

Author contributions: R.A.B., J.G.S., and P.R.G. designed research; R.A.B., J.G.S., B.F., A.G., and P.R.G. performed research; R.A.B., J.G.S., B.F., S.P.S., R.W.L., E.L.B., A.G., G.W.L., J.S.S., and C.R.F. analyzed data; and R.A.B. and P.R.G. wrote the paper. The authors declare no conflict of interest. *This Direct Submission article had a prearranged editor. Freely available online through the PNAS open access option. Data deposition: The sequences reported in this paper have been deposited in the GenBank database [accession nos. JN402310, JN402311, JQ624362–JQ624411 (Alviniconcha spp. host mitochondrial CO1 sequences), and JN377487, JN377488, JN377489 (symbiont 16S rRNA gene sequences)].
1

To whom correspondence should be addressed. E-mail: pgirguis@oeb.harvard.edu.

This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. 1073/pnas.1202690109/-/DCSupplemental.

PNAS Early Edition | 1 of 10

ECOLOGY

PNAS PLUS

! ! ! !
14

!

host and symbiont to ascertain whether there is evidence for symbiont-influenced niche partitioning at vents. Despite a convergence of general function among chemosynthetic symbioses in which the endosymbionts provide primary nutrition for the host, chemolithoautotrophic symbiont lineages have evolved multiple times from distinct lineages of free-living Proteobacteria (13, 31), and the genetic distance within and among symbiont lineages is sufficient to posit that physiological differences exist among them. Indeed, ongoing studies of chemosynthetic symbioses continue to reveal diverse modes of energy metabolism, such as hydrogen and carbon monoxide oxidation (32, 33). Given the obligate nature of these associations, the ecological implications of differences in symbiont physiological capacity are quite significant, because they may enable niche partitioning that results in previously inexplicable or unrecognized distribution patterns. If there are physiological differences among the symbionts of given groups (genera or species) of hosts, symbiont physiological activity would have the potential to constrain host habitat utilization via differences in chemolithotrophic metabolism. Provannid gastropods of the genus Alviniconcha provide a unique opportunity to study symbiont-driven host niche partitioning. Alviniconcha are widely distributed at vents in the western Pacific (Manus Basin, Marianas Trough, North Fiji Basin, and the Lau Basin) as well as in the Indian Ocean at vents along the Central Indian Ridge. In addition to the described species of Alviniconcha, previous studies have found additional host “types” which are sufficiently divergent that they may represent undescribed species (34–36). These species and host types have been observed to host either intracellular γor ε-proteobacterial symbionts in the gill (36–40). Studies of the distribution of these species and types among vent fields examined a modest number of specimens per site (e.g., two individuals from each sampling site), with little or no contextual habitat information. As such, it is impractical to infer from these data the relationship between host type, symbiont type, and habitat utilization.

To look for patterns indicative of symbiont-influenced habitat partitioning, we collected 288 Alviniconcha individuals from the walls of hydrothermal chimneys and diffuse-flow habitats (where hydrothermal fluid is emitted from cracks in the seafloor) (Fig. 1 and Table S1). Alviniconcha were sampled from four vent fields spanning a regional geological gradient, where the two northernmost fields (Tow Cam and Kilo Moana) are dominated by basaltic lava, and the two southernmost vents (ABE and Tu’i Malila) are dominated by andesitic lava (41–45). Coregistered measurements of the physicochemical habitat within the animal collections, as well as characterization of vent end-member fluids from within each field, provide contextual geochemical information for these samples. Both host and symbionts were subject to phylogenetic analyses, and the composition of the symbiont population of all individuals was determined via quantitative PCR (qPCR). Select samples were also analyzed for stable-carbon isotopic content. Collectively, these data reveal striking patterns of both host and symbiont (holobiont) distribution along an ∼300-km length of the ELSC. The observed patterns in holobiont distribution correlate with differences in vent-fluid composition along the ELSC, implicating Alviniconcha symbionts in governing the distribution of their hosts among vent fields. These data provide evidence that symbiont complement might influence niche partitioning within a closely related group of animals and might in this case, as a consequence of differences in geochemical composition along the entire spreading center, yield regional-scale patterns of holobiont distribution. Results chondrial cytochrome C oxidase subunit 1 (CO1) from 274 host individuals and recovered a total of 56 haplotypes (Table S2). These haplotypes were distributed among three major clades with high (>0.95) posterior support, corresponding to three host types from the southwestern Pacific, and are called type 1 (HT-I), type 2 (HT-II), and type Lau (which we renamed here HT-III) (Fig. 2). Only HT-III has been previously described from the Lau Basin (38). Our results corroborate the Alviniconcha phylogeny as published in ref. 38, in which one major clade includes HT-I, HT-III, and Alviniconcha hessleri (from the Mariana trench), and the second major clade includes HTII and A. aff. hessleri (from the Indian Ocean). For HT-I and HT-II, reference sequences AB235211 and AB235212 were each identical to the most common experimental haplotype in their respective clade; AB235215, representing HT-III, was identical to a relatively rare haplotype in our dataset but had only one nucleotide difference from the most common HT-III haplotype. The three host types found on the ELSC were divergent from those observed in the northwestern Pacific (Mariana Trench) and the Indian Ocean. Some structure was apparent within the major host types in our sample. Within HT-III, a clade including 11 of the 22 HT-III haplotypes was supported with a posterior probability approaching 1.0. Although structure also was apparent in other host types, none was resolved with a posterior probability exceeding 0.9.
Phylogenetic Analyses of Symbiont 16S rRNA Genes. Based on 16S rRNA gene sequences, three symbiont phylotypes were found to be associated with ELSC Alviniconcha, only one of which had been previously observed in this region. Longer sequences were generated from clones of each phylotype for phylogenetic analysis (Fig. 3) and revealed that the three phylotypes are closely related to the previously published sequences for the γ- and ε-proteobacterial endosymbionts from Alviniconcha in this and other hydrothermal systems in the southwestern Pacific (Manus and North Fiji basins) (36–38). One of the γ-proteobacterial symbiont phylotypes, γ-Lau, was most closely related to the previously published symbiont sequence from Alviniconcha in the Lau Basin
Beinart et al.

Phylogenetic Analysis of the Host Mitochondrial Cytochrome C Oxidase Subunit 1 Gene. We successfully amplified partial mito-

Fig. 1. (A) Map of ELSC depicting the four vent fields sampled herein. (Inset) Location of ELSC in the South Pacific. (B) A typical assemblage of Alviniconcha (Al) and other vent animals in the Lau Basin (Image courtesy of James Childress, University of California, Santa Barbara). (C) An individual Alviniconcha snail.
2 of 10 | www.pnas.org/cgi/doi/10.1073/pnas.1202690109

! ! ! !
15

!

Fig. 2. Bayesian inference phylogeny of the Alviniconcha host mitochondrial CO1 haplotypes from this and previous studies and sequences from the sister genus Ifremeria. Boxes show the three Alviniconcha host types reported here. The haplotype ID number is shown at the tip of each branch, and the gray bars represent the total number of individuals recovered for each haplotype. Accession numbers for haplotypes found in this study are given in Table S2. Posterior probabilities are indicated above the nodes if >0.7.

(98% sequence identity) (38). The second γ-proteobacterial symbiont, phylotype γ-1, and an ε-proteobacterial symbiont phylotype were most closely related (96–97% and 97% sequence identity, respectively) to Alviniconcha symbionts previously observed in the North Fiji and Manus basins (38).
Proportion of Symbiont Phylotypes Within Alviniconcha. Quantification via qPCR revealed that all Alviniconcha individuals analyzed were dominated (>67% of total detected 16S rRNA genes) by either γ- or ε-proteobacterial endosymbionts. The dominant phylotype on average represented 99.5 ± 2.2% of the total symbiont gene counts within all individuals (Fig. 4). We never observed individual snails with approximately equal representation of γ- and ε-proteobacteria, although we did observe individuals with roughly equal representation of the two γ-proteobacterial phylotypes. Accordingly, we refer to Alviniconcha individuals as primarily hosting either γ- or ε-proteobacterial endosymbionts. Relationships Among Symbiont Phylotypes and Host Types. Our qPCR analysis also revealed specificity among the three host types and three symbiont phylotypes. One-way analysis of similarity (ANOSIM) comparing the symbiont composition among the different host types demonstrated that each host type associated with significantly different symbiont populations (global
Beinart et al.

R = 0.789, P < 0.001) (Fig. 4). HT-II were exclusively dominated by ε-proteobacteria, with ε-proteobacteria always representing >99% of the detected symbiont genes. Accordingly, we found no significant differences in the symbiont population among HT-II from three different vent fields (one-way ANOSIM; global R = 0.312, P = 0.07). HT-III, conversely, were exclusively dominated by γ-proteobacteria, either γ-1 or γ-Lau. A small number of HTIII individuals (n = 7, hereafter called “γ-Both”) had relatively equal proportions of both γ-proteobacterial phylotypes. HT-III was found at the two southernmost vent fields (ABE and Tu’i Malila); however, because of the presence of only one HT-III individual at ABE, we were unable to statistically test the effect of geography on symbiont population composition in this host type. Finally, HT-I was dominated by either γ-1 or ε-proteobacteria but moret commonly dominated by γ-1, not the ε-proteobacteria (n = 93 vs. 6 individuals respectively). In this host type, the associated symbiont population displayed different patterns of symbiont fidelity according to geography. HT-I was found at all four vent fields; however, the dominant symbiont phylotype changed from north to south. Five of 12 HT-I individuals in the northern vent fields were dominated by ε-proteobacteria, compared with only 1 of 87 HT-I individuals in the southern vent fields. This finding was confirmed via one-way ANOSIM comparing the symbiont population of HT-I by location, which
PNAS Early Edition | 3 of 10

ECOLOGY

PNAS PLUS

! ! ! !
16

!

A

B

Fig. 3. Bayesian inference phylogenies of 16S rRNA sequences showing the three Alviniconcha symbiont phylotypes found at the ELSC. All Alviniconcha symbionts, from this study and others, are shown in bold. Gray highlighting indicates the representative sequences from this study. Boxes show the Alviniconcha symbiont phylotypes defined here and in other studies. Posterior probabilities are indicated above the nodes if >0.7. (A) γ-proteobacterial phylogeny, with β-proteobacteria as the outgroup. (B) ε-proteobacterial phylogeny, with δ-proteobacteria as the outgroup.

demonstrated that there were significant differences among HT-I individuals from the different vent fields (global R = 0.385, P < 0.001).
Geographic Patterns in the Abundance of Alviniconcha Host Types.

The distribution and abundance of each host type varied geographically from north to south (Fig. 5). HT-I was found at all
4 of 10 | www.pnas.org/cgi/doi/10.1073/pnas.1202690109

four vent fields, HT-II was found at three vent fields but not Tu’i Malila, and HT-III was found at the two southernmost vent fields, ABE and Tu’i Malila. With respect to their relative abundance, Alviniconcha populations at the northern vent fields were mainly HT-II, whereas populations at the southern vent fields were mainly HT-I and HT-III. The relative abundances of host types in the two northern vent fields (Kilo Moana and Tow
Beinart et al.

! !
17

!

northern and southern fields. Indeed, when grouped by habitat type regardless of region, diffuse flows and chimney wall habitats measured here did not have significantly different sulfide concentrations (Mann–Whitney U, P = 0.126) (Table S1 and Fig. 6), nor did diffuse flows and chimneys within the same region (Mann–Whitney U, P = 0.182 and P = 0.102, north and south respectively). We also did not detect any significant differences in the oxygen concentrations or temperature of the vent fluids among the sample collection sites in the northern and southern vent fields (P = 0.180 and P = 0.118 respectively).
End-Member Vent-Fluid Chemistry. End-member aqueous concentrations of H2S and hydrogen (H2) reveal along-axis geochemical variations from north to south (Fig. 7). End-member aqueous H2 concentrations varied from 220–498 μM in the northernmost vents (at Kilo Moana) and decreased to concentrations that varied from 35–135 μM in the southernmost (at Tu’i Malila) vents, nearly an order-of-magnitude difference in concentration. End-member dissolved H2S concentrations exhibit a similar trend from north to south, although the ∼twofold change in concentration of 4.9–2.8 mM from north to south is substantially

Fig. 4. Ternary plots of the symbiont composition of each Alviniconcha host type, with each point showing the symbiont composition of a single individual. The vertices of the triangle represent 100% of each symbiont phylotype, and the tick marks on the axes represent decreasing intervals of 10%. The symbiont phylotypes are indicated by γ-1 (γ-proteobacteria type 1), γ-Lau (γ-proteobacteria type Lau), and ε (ε-proteobacteria). Vent fields are indicated by ● (Kilo Moana), □ (Tow Cam), X (ABE), and ▽ (Tu’i Malila).

Cam) versus two southern vent fields (ABE and Tu’i Malila) were significantly different (global R = 0.34, P = 0.03).
Geographic Abundance of Symbiont Phylotypes. The abundance of symbiont phylotypes associated with Alviniconcha changed along the spreading center (Fig. 5). Individuals dominated by symbiont γ-1 were present at all four vent fields. Individuals dominated by ε-proteobacteria were present three vent fields but not Tu’i Malila. Individuals dominated by γ-Lau were observed only at Tu’i Malila. The dominant symbiont phylotypes in Alviniconcha from the two northern vent fields (Kilo Moana and Tow Cam) were significantly different from those of the southern two vent fields (ABE and Tu’i Malila) (one-way ANOSIM, global R = 0.409, P = 0.024). Specifically, the majority of Alviniconcha at the northern vent fields (Kilo Moana and Tow Cam) were dominated by ε-proteobacteria, whereas the majority of Alviniconcha at the southern vent fields (ABE and Tu’i Malila) were dominated by one of the two γ-proteobacterial phylotypes.

thermal measurements were taken upon the cleared substratum after Alviniconcha collections were completed (Table S1 and Fig. 6). Free sulfide concentrations in the vent fluids of the northernmost Alviniconcha habitats were significantly greater than those of the southernmost habitats (Mann–Whitney U, P = 0.038). Although we happened to sample more chimney wall habitats in the north, this difference in sampling does not explain the significant difference in sulfide concentrations between
Beinart et al.

Chemistry and Temperature at Alviniconcha Habitats. Chemical and

Fig. 5. The distribution of Alviniconcha host types and dominant symbiont type across the ELSC, with each individual colored according to dominant symbiont phylotype (>67% of the total detected 16S rRNA genes) and shaped according to host type. The four vent fields are separated by solid lines, and distinct collections from within each vent field are divided by dashed lines, with the collection ID indicated (Table S1). Symbiont phylotypes are indicated as follows: green, γ-proteobacteria type 1 (γ-1); yellow, γ-proteobacteria type Lau (γ-Lau); blue, ε-proteobacteria (ε).The individuals that had relatively equal proportions of two of the symbiont phylotypes are shown as two colors. Host types are indicated by shapes: ●, host type 1 (HT-I); ■, host type II (HT-II); ▲, host type III (HT-III); ◆, host type undetermined.
PNAS Early Edition | 5 of 10

ECOLOGY

PNAS PLUS

! ! ! !
18

!

A

B

C

individuals grouped by dominant symbiont phylotype (γ-1, n = 23; γ-Lau, n = 21; γ-Both, n = 8), irrespective of host type, showed that there were significant differences among the groups (P < 0.001). Tukey’s multiple pairwise comparisons showed that the δ13C value in individuals dominated by γ-Lau was not significantly different from that in γ-Both individuals (P = 0.834), whereas individuals dominated by either γ-Lau or γ-Both were significantly less depleted than individuals dominated by γ-1 (P = 0.001 and P = 0.004, respectively). We were unable to compare the possible effects of host type on the stable-carbon isotopic composition in this subset of individuals, because we did not have enough individuals of different host types with the same dominant symbiont phylotype for statistical analysis. Discussion These analyses, which were based on an extensive sampling effort in four different vent fields along the length of the ELSC, uncover previously cryptic, regional-scale patterns in the distribution of Alviniconcha holobionts. Our results suggest that regional-scale gradients in geochemistry, which are the surficial expression of subsurface tectonic processes and water–rock interactions, respectively, influence niche availability—and thus partitioning—among hydrothermal vent symbioses. Specifically, we observed striking patterns in the distribution of Alviniconcha host types, wherein Alviniconcha associated with ε-proteobacteria were substantially more abundant at the northernmost, basaltic vent fields (Kilo Moana and Tow Cam). Conversely, Alviniconcha associated with γ-proteobacteria were more abundant at the andesitic southern vent fields (ABE and Tu’i Malila) (42, 43). We observed further basin-wide geographic trends in Alviniconcha individuals hosting different γ-proteobacterial symbionts, including the absence of individuals dominated by the γ-Lau phylotype from all except the Tu’i Malila vent fields. Together, with geochemical data from high-temperature and diffuse vent fluids from these vent fields, our results indicate that niche partitioning within a genus of chemosynthetic symbioses at deep sea hydrothermal vents is linked to subsurface geological/ geochemical processes. These data suggest that interactions between symbionts and the physicochemical habitat, rather than host physiology alone, can govern the distribution of hydrothermal vent symbioses across a biogeographical province.
Symbiont and Host Diversity and Association. The cryptic diversity revealed here reshapes our understanding of the biogeography of this genus. Before this study, only HT-III (previously called “host type Lau”) and one symbiont phylotype (γ-Lau) had been documented in the Lau Basin (38). Our phylogenetic surveys uncovered two additional host types (HT-I and HT-II) and two additional symbiont phylotypes (γ-1 and ε-proteobacterial) within the ELSC. Collectively, these data establish the ELSC as the geographic area with the highest documented diversity for this genus, with a greater number of host types and symbiont phylotypes than in any other region. [It is possible that Alviniconcha hosts and symbionts are comparably diverse at other western Pacific and Indian Ocean vent systems, although this remains to be determined (36–38, 40).] Regardless, the data herein show unforeseen holobiont diversity within the genus Alviniconcha and emphasize the value of interrogating both host and symbiont identity at an appropriate sampling scale to capture cryptic phylogenetic diversity. The observed patterns of association among the host and symbiont phylotypes were most surprising. 16S rRNA gene qPCR of all sampled individuals revealed that Alviniconcha host types exhibited varying degrees of specificity for their symbionts. Alviniconcha HT-II associated solely with ε-proteobacteria. HT-III hosted mixed populations of the two γ-proteobacterial phylotypes (γ-Lau and γ-1). Notably, HT-I associated with both γ- or ε-proteobacterial endosymbionts, sometimes within the same individual (although one endosymbiont always dominated).
Beinart et al.

Fig. 6. Cyclic voltammetry measurements made on the cleared substratum after Alviniconcha collections, showing (A) temperature, (B) free sulfide concentration (sulfide), and (C) oxygen concentration at northern collections versus the southern collections. North (N) includes the vent fields Kilo Moana (KM) and Tow Cam (TC); South (S) includes ABE and Tu’i Malila (TM). Symbols with horizontal lines represent samples from diffuse vent flows; symbols without lines represent chimney wall habitats. Median values for each region are indicated by a dashed horizontal line.

less than that observed for aqueous H2. In contrast to H2 and H2S, end-member methane (CH4) concentrations in 2009 occupied a very narrow range of 33–44 μM and showed no along-axis trends (Fig. 7). End-member aqueous dissolved inorganic carbon (DIC) concentrations were highest in the Tu’i Malila vent fluid, reaching a value of 15 mM, and lowest in ABE vent fluids where concentrations varied from 5.4–7.0 mM, with fluids from the other vent fields containing intermediate concentrations of DIC (Fig. 7). End-member CH4 and DIC concentrations did not change markedly from 2005 to 2009.
Stable Carbon Isotopic Composition According to Dominant Symbiont 13 Phylotype. Across the ELSC, the average δ C value for gill tissue

from Alviniconcha dominated by ε-proteobacteria (−11.6 ± 0.4‰) was much less depleted than the average value of Alviniconcha dominated by γ-proteobacteria (−27.6 ± 2.3‰) (Table S3). A one-way ANOVA of Tu’i Malila γ-proteobacteria hosting

A

C

B

D

Fig. 7. The end-member fluid concentrations of (A) H2, (B) H2S, (C) CH4, and (D) DIC at the four vent fields along the ELSC from which Alviniconcha were collected. Symbols indicate year of sampling: X, 2005; ●, 2009. DIC and H2S data from 2005 were published previously by Mottl et al. (44).
6 of 10 | www.pnas.org/cgi/doi/10.1073/pnas.1202690109

! ! ! !
19

!

Although some species of Bathymodiolus hydrothermal vent mussels are known to associate with two endosymbiotic γ-proteobacterial phylotypes (46–48), the ability of an Alviniconcha individual to host endosymbionts from two distinct bacterial classes is unprecedented among chemosynthetic symbioses. These symbionts are thought to be environmentally acquired (49), and the observed patterns of symbiont distribution among host types suggest interplay between host specificity and environmental determinants. This interplay may have a profound role in structuring the distribution of Alviniconcha host types across available niche space.
Holobiont Distribution and Basin-Wide Geochemical Gradients. Further investigation revealed that the holobionts exhibited a structured pattern of distribution across the four vent fields. Although Alviniconcha HT-I and the symbiont γ-1 were represented at all four vent fields, individuals dominated by the symbiont γ-Lau were observed at only one vent field (Tu’i Malila), and only one HT-III individual was found outside of Tu’i Malila. Structured distributions of marine fauna often result from geographical isolation or other barriers to dispersal (50, 51). However, the representation of host HT-I and symbiont phylotype γ-1 among all of the vents studied here, combined with our recovery of host haplotypes identical to previously collected individuals from thousands of kilometers away, suggests that the existence of such barriers is unlikely. Alviniconcha are thought to produce fardispersing planktotrophic larvae (52), and studies of deepwater circulation in the ELSC have revealed continuity among the sites (53). Thus, the potential for geographic isolation caused by limitations on larval dispersal or deepwater circulation along the ELSC seems low. Geological and geochemical gradients along the spreading center better explain the observed holobiont distributions. The ELSC comprises a series of vent fields in the Lau back-arc basin created by the subduction of the Pacific plate under the IndoAustralian plate. As the ELSC proceeds from north to south, it approaches the volcanic arc, resulting in an increased influence of the subducting Pacific plate on the crustal rocks (54–56). Consequently, there is a change in crustal rock type, with vent fields in the north being dominated by basalt and vent fields in the south being dominated by basaltic-andesite and andesitic lavas (42, 43). The increasing influence of the subducting slab is reflected in the changing geochemical composition of vent fluids north to south along the spreading center, including sizeable differences in dissolved volatile concentrations (28, 44, 45). Our analyses of hightemperature vent effluents from among the sampling sites revealed variations in gross geochemical composition along the ELSC that appear to be stable over time (44, 45). Both H2 and H2S concentrations decrease from north to south, with H2 showing about an order-of-magnitude difference in concentration in endmember fluids from Kilo Moana in the north (∼500 μM) to Tu’i Malila in the south (∼43 μM). Because there often is a correspondence between the geochemical composition of a diffuse flow and nearby high-temperature flow (57–59), the elevated H2 and H2S concentrations in the high-temperature fluids at the northern vent sites likely correspond to higher concentrations of these chemical species in the cooler vent fluids bathing the Alviniconcha at these fields. Indeed, in situ voltammetry of vent fluids from among the collections corroborated the above geochemical trend and established that sulfide concentrations were higher among the Alviniconcha aggregations in the northern vent fields, although temperature and oxygen concentrations were not significantly different among the collection sites. Niche Partitioning. If there are functional differences among Alviniconcha symbionts, then each host type’s specificity for a particular symbiont would influence its capacity to exploit different physicochemical niches. Given the aforementioned distribution of phyloBeinart et al.

types and the seeming lack of barriers to dispersal, we posit that the observed patterns of distribution of Alviniconcha across the ELSC relates to the gradients in vent-fluid geochemistry (Fig. 7). Holobionts with ε-proteobacterial symbionts dominated in fields with higher H2 and H2S concentrations, and conversely holobionts with γ-proteobacterial symbionts were in greater abundance at fields with lower H2 and H2S. This observation is consistent with studies of free-living ε- and γ-proteobacteria in sulfidic environments, which found that ε-proteobacteria dominate over γ-proteobacteria in habitats with higher sulfide (60–62). Both H2 and sulfur oxidation are known to be common metabolisms among the close relatives (i.e., Sulfurimonas spp.) of the ε-proteobacterial symbionts (60, 63–65), and we hypothesize that one or both of these mechanisms supports autotrophy in this phylotype. Previous studies of Alviniconcha symbiont metabolism have focused on sulfide oxidation in vivo and in vitro (39, 66) but did not identify the symbionts, so it is unclear which phylotypes are engaged in this metabolism. We observed that holobionts with ε-proteobacteria did not have visible sulfur granules (a known intermediate in some sulfur oxidation pathways) in their gills. In contrast, holobionts with γ-proteobacteria had elemental sulfur in their gills, suggesting different modes of sulfur metabolism. This finding, too, is consistent with studies of sulfur oxidation by ε- and γ-proteobacteria, which are known to use different pathways (reviewed in ref. 60). We recognize that other factors, yet to be determined, could influence the north-to-south partitioning of ε- and γ-proteobacterial symbionts as well as the distribution of holobionts with γ-Lau and γ-1, along the ELSC. Further work identifying the specific reductants and pathways used by the three symbiont phylotypes is needed to better understand the connection between symbiont physiology and the observed habitat partitioning. We also observed evidence for niche partitioning at a local (vent-field) scale. Most collections were dominated by holobionts associating with one particular symbiont type (e.g., HT-I and II both hosting ε-proteobacterial symbionts in collection TC-2) (Fig. 5). This patchiness does not correspond strictly to habitat type (chimney wall vs. diffuse flows), because collections from both habitat types were dominated by ε-proteobacterial symbionts in the north and, conversely, by γ-proteobacterial symbionts in the south. There are anomalous collections from Kilo Moana and ABE that deviate from the overarching patterns of distribution in this study and that reflect local patchiness in geochemistry. Indeed, if these patterns are driven by habitat conditions, we would expect local variation in chemistry to result in patchy holobiont distribution even within a vent field. Unfortunately, we did not collect environmental data at these specific sites, so we cannot determine whether these collections were associated with different geochemistry. Although higher-resolution sampling of Alviniconcha with associated fine-scale chemical measurements is necessary to understand the extent of intrafield habitat partitioning by these symbioses, the existing data suggest interactions between the symbionts and the environment. Previous studies have hypothesized that differences in the oxygen tolerance of the carbon fixation pathways used by the γand ε-proteobacterial symbionts could influence habitat utilization by the different Alviniconcha symbioses (38, 61). Indeed, our measurements of carbon-stable isotopic composition are consistent with the use of different carbon-fixation pathways by the γand ε-proteobacterial symbionts (Table S3). However, the oxygen concentrations were not significantly different in the habitats occupied by individuals with the γ- and ε-proteobacterial symbionts. Moreover, it is unlikely that environmental oxygen concentrations are experienced by the symbionts, because host oxygen-binding proteins, such as the gill hemoglobin of Alviniconcha (67), have a high affinity for oxygen and will govern its partial pressure within the host’s tissues. With respect to whether differences in host physiology influence the observed distribution patterns, little is known about differences in thermal tolerance or
PNAS Early Edition | 7 of 10

ECOLOGY

PNAS PLUS

! ! ! !
20

!

chemotolerance among Alviniconcha host types (66). Sulfide tolerance has been suggested to affect animal distribution at vents (23, 27, 68) and is significantly different among collections dominated by the different Alviniconcha holobionts at the ELSC. However, the highest sulfide levels detected among the snails in our collections are well below the tolerance limits reported from shipboard experiments on Alviniconcha, and thus host tolerance for sulfide is unlikely to be responsible for the patterns we report (66). Additionally, temperature and oxygen concentrations—two key factors often invoked in governing the distribution of animals at vents (23)—were not significantly different among our collection sites. Although both host and symbiont physiology undoubtedly influence the overall niche of these holobionts, we suggest that host physiology is unlikely to play a major role in the habitat partitioning observed here. Conclusions For vent holobionts, access to vent-derived chemical resources (reduced compounds for chemolithoautotrophy) requires physical proximity to the emitted vent fluid, as evidenced by the strong association of chemosynthetic symbioses with vent-fluid emissions (e.g., ref. 28). Competition among these holobionts for chemical resources takes the form of competition for the limited space near vent flows. Within a chemically heterogeneous vent system such as the ELSC, with spatial variability in the composition of vent fluid, resource partitioning among symbioses appears to occur via the differential distribution of the symbioses across the range of geochemical milieus. Here, we observed this process occurring both within a genus and at a regional scale, with differential distribution of holobionts among distinct vent fields that are tens of kilometers apart. In many ecosystems, niche partitioning has been shown to facilitate the coexistence of ecologically similar taxa (reviewed in ref. 3) but generally has been considered in the context of the intrinsic differences in organisms, not in differences in their symbionts. Despite growing knowledge of the ubiquity of symbioses in the natural world, evidence for their effects on niche partitioning among similar hosts is surprisingly rare. In a few animal–microbial symbioses, namely coral–algal and aphid–bacterial associations, studies have correlated microbial symbiont genetic and physiological diversity with niche partitioning by the symbioses. In these cases, specificity in partnering among physiologically distinct endosymbiont phylotypes and genetically distinct hosts has been found to correspond to the distribution of corals in different light and temperature regimes on reefs (69–74) and to the distribution of aphids on different plant types (75–77). Previous research on the relationship between symbiont identity and environmental geochemistry at hydrothermal vents examined how differences in symbiont phylotype and abundance varied within a single species of mussel as a function of habitat (47, 78–80). It now is apparent that the process of symbiont-influenced niche partitioning among genetically distinct hosts is likely to play a role in structuring vent ecosystems and is driven by subsurface geological and geochemical interactions. The influence of symbiont metabolism on host niche utilization is fundamental to our understanding of hydrothermal vent symbioses and vent ecosystems. With increasing awareness of the prevalence of microbe–animal interactions in our biosphere, the process of symbiont-driven niche partitioning is likely to be elemental in other biological systems as well. Methods
Alviniconcha Specimens. A total of 288 Alviniconcha specimens were collected from four vent fields in the ELSC using the remotely operated vehicle (ROV) Jason II during expedition TM-235 in 2009 on board the R/V Thomas G. Thompson (Fig. 1 and Table S1). Sites were chosen randomly, and live specimens were collected using modified “mussel pots” (81, 82) or large scoop nets and were returned to the ship in insulated containers. On board ship, live specimens were kept in chilled (4 °C) seawater until dissection. Symbiont8 of 10 | www.pnas.org/cgi/doi/10.1073/pnas.1202690109

containing gill tissues were dissected on shipboard and were frozen immediately at −80 °C. The frozen tissue remained at −80 °C until it was subsampled for DNA extraction and carbon isotope analysis. Free Sulfide, Oxygen, and Temperature Determination via in Situ Voltammetry. In situ voltammetry and a temperature probe were used to determine free sulfide and oxygen concentrations as well as fluid temperatures associated with a subset of the Alviniconcha collections (Table S1) (83, 84). Measurements were made in the same manner for both diffuse flows and chimney walls. Briefly, animals were collected, and then 1–12 scan sets were performed with the tip of the probe directly on the cleared substrate. Each scan set was comprised of 7–12 discrete measurements (scans), which then were averaged. At the diffuse-flow sites, measurements were made on the cleared substratum after animals were collected. At the chimney wall sites, after animals were collected, the probe was positioned directly along the side of the perpendicular to chimney wall structure, so that the tip touched or was within 1 cm of touching the chimney wall (based on the laser scale from the ROV Jason). In all cases, shimmering water often was visible, and temperatures never were higher than 60 °C. The instrument’s quantitative limits of detection for free sulfide and oxygen are 0.2 μM and 15 μM, respectively. For statistical analyses, values below the quantitative limits of detection were treated as in ref. 28. End-Member Vent-Fluid Sampling and Analyses. Hydrothermal fluids were recovered from high-temperature orifices (temperatures ranged from 268– 320 °C) using the ROV Jason II and isobaric gas-tight fluid samplers (85) during expedition TM-236 in June–July 2009 on the R/V Thomas G. Thompson. Samples were analyzed for dissolved CH4, H2S, and DIC. Dissolved CH4, DIC, and H2 also were measured at the vent fields sampled during this study during expedition TUIM05MV on the R/V Melville (April–May 2005) (see ref. 44 for 2005 sample information). All fluid samples were processed via gas chromatography or gravimetry as in ref. 44. See SI Methods for details of end-member calculations. DNA Extraction. Approximately 25 mg of gill tissue was subsampled while frozen for DNA extraction. Each subsample was placed into one well of a 96well plate containing a proprietary lysis buffer from the AutoGenprep 965/ 960 Tissue DNA Extraction kit (AutoGen, Inc.), and DNA was extracted with the AutoGenprep 965 automatic extraction system. Before downstream analysis, all DNA extracts were diluted 1:100 in molecular-grade sterile water to minimize the effect of any coextracted inhibitors on downstream molecular analysis. Phylogenetic Analysis of the Host Mitochondrial CO1 Gene. DNA extracts from all Alviniconcha individuals were used as template to partially amplify the CO1 mitochondrial gene, and the resulting sequences were cleaned, trimmed, and aligned and then were used to produce a Bayesian inference phylogeny using the SRD06 model of nucleotide evolution (86), which partitions the protein coding sequence into first plus second and third codon positions, estimating parameters for each. Details of these analyses can be found in SI Methods. Host CO1 gene sequences were deposited in GenBank, and accession numbers are given in Table S2. Phylogenetic Analysis of Symbiont 16S rRNA Genes. Universal bacterial primers were used to amplify symbiont 16S rRNA genes from the DNA extracts of 30 individuals from ABE and Tu’i Malila. A clone library was constructed from the pooled amplicons of individuals from each vent field, and sequence diversity was assessed via partial sequencing of clones (see SI Methods for GenBank accession numbers). The clones were found to represent three phylotypes with >96% identity to previously sequenced Alviniconcha symbionts. Bidirectional sequencing of clones representative for each symbiont phylotype yielded longer sequences (accession numbers JN377487, JN377488, JN377489), which were cleaned, trimmed, and aligned with other 16S rRNA gene sequences from both free-living and symbiotic Proteobacteria and then were used to produce a Bayesian inference phylogeny with BEAST (87) implementing the GTR+I+G model of substitution. Details of these analyses can be found in SI Methods. Symbiont qPCR Assay Development. SYBR Green qPCR primers (Table S4) were designed for the three symbiont phylotypes using the aforementioned 16S rRNA gene alignment. Each phylotype assay was designed to target Alviniconcha symbiont 16S rRNA gene sequences from this study and others to capture intraphylotype sequence diversity. Details of qPCR assay design and optimization are given in SI Methods.
Beinart et al.

! ! ! !
21

!

Assessing Symbiont Composition via qPCR. To confirm that our subsamples yielded symbiont populations typical of the entire gill, we took three subsamples (from either end and the middle of each gill) from the whole gills of six individuals, extracted DNA as described above, and found that the proportion of symbiont phylotypes varied by <1% among subsamples (Table S5). We accordingly estimated the proportion of each symbiont phylotype in the original Alviniconcha gill DNA extracts by applying all three qPCR assays to 2 μL of each sample (in duplicate), which were compared against duplicate standard curves and no-template controls and then were averaged to determine copy number. Reactions in which the cycle threshold (Ct) was greater than the Ct for the lowest standard (10 copies) were documented as zero copies. Additionally, all quantities were adjusted for amplification inhibition (SI Methods). Symbiont populations within an individual were assessed by assuming each 16S rRNA gene to represent a single symbiont genome (see SI Methods for discussion of this assumption). Analysis of Carbon Isotopic Composition. Approximately 300 mg gill tissue was subsampled while frozen for carbon isotopic analysis. Samples were lyophilized for 24 h and then were acidified with 0.1 N HCl to remove any inorganic carbon contamination. The samples subsequently were dried for 24–48 h at 50–60 °C, homogenized to a fine powder, and sealed within tin capsules. The carbon isotopic composition was determined by combustion in an elemental analyzer (Eurovector, Inc.) and separating the evolved CO2 by gas chromatography before introduction to a Micromass Isoprime isotope ratio mass spectrometer for determination of 13C/12C ratios. Measurements are reported in δ-notation relative to the Peedee belemnite in parts per thousand deviations (‰). Typical precision of analyses was ±0.2‰ for δ13C. Egg albumin was used as a daily reference standard.
1. Chase JM, Leibold MA (2003) Ecological Niches: Linking Classical and Contemporary Approaches (Univ of Chicago Press, Chicago). 2. Leibold MA, McPeek MA (2006) Coexistence of the niche and neutral perspectives in community ecology. Ecology 87(6):1399–1410. 3. Chesson P (2000) Mechanisms of maintenance of species diversity. Annual Review of Ecology and Systematics 31:343–366. 4. Schoener TW (1974) Resource partitioning in ecological communities. Science 185 (4145):27–39. 5. Schoener TW (1986) Resource partitioning. Community Ecology: Pattern and Process, eds Kikkawa J, Anderson DJ (Blackwell Scientific Publications, Boston), pp 91–126. 6. Fisher CR, Takai K, Le Bris N (2007) Hydrothermal vent ecosystems. Oceanography (Washington DC) 20(1):14–23. 7. Van Dover CL (2000) The Ecology of Deep-Sea Hydrothermal Vents (Princeton Univ Press, Princeton). 8. Cavanaugh CM, Gardiner SL, Jones ML, Jannasch HW, Waterbury JB (1981) Prokaryotic cells in the hydrothermal vent tube worm Riftia pachyptila Jones: Possible Chemoautotrophic Symbionts. Science 213(4505):340–342. 9. Fisher CR, Childress JJ, Minnich E (1989) Autotrophic carbon fixation by the chemoautotrophic symbionts of Riftia pachyptila. The Biological Bulletin 177(3):372–385. 10. Felbeck H (1981) Chemoautotrophic potential of the hydrothermal vent tube worm, Riftia pachyptila Jones (Vestimentifera). Science 213(4505):336–338. 11. Belkin S, Nelson DC, Jannasch HW (1986) Symbiotic assimilation of CO2 in the two hydrothermal vent animals, the mussel Bathymodiolus thermophilus and the tubeworm Riftia pachyptila. The Biological Bulletin 170(1):110–121. 12. Nelson DC, Hagen KD, Edwards DB (1995) The gill symbiont of the hydrothermal vent mussel Bathymodiolus thermophilus is a psychrophilic, chemoautotrophic, sulfur bacterium. Marine Biology 121(3):487–495. 13. Dubilier N, Bergin C, Lott C (2008) Symbiotic diversity in marine animals: The art of harnessing chemosynthesis. Nat Rev Microbiol 6(10):725–740. 14. Ramirez-Llodra E, Shank TM, German CR (2007) Biodiversity and biogeography of hydrothermal vent species thirty years of discovery and investigations. Oceanography (Washington DC) 20(1):30–41. 15. Butterfield DA, et al. (1994) Gradients in the composition of hydrothermal fluids from the Endeavour segment vent field: Phase separation and brine loss. Journal of Geophysical Research 99(B5):9561–9583. 16. Butterfield DA, Massoth GJ, McDuff RE, Lupton JE, Lilley MD (1990) Geochemistry of hydrothermal fluids from axial seamount hydrothermal emissions study vent field, Juan-de-Fuca Ridge - subseafloor boiling and subsequent fluid-rock interaction. Journal of Geophysical Research-Solid Earth and Planets 95(B8):12895–12921. 17. Von Damm KL (1995) Controls on the chemistry and temporal variability of seafloor hydrothermal fluids. Seafloor Hydrothermal Systems: Physical, Chemical, Biological, and Geological Interactions, Geophys Monogr Ser (American Geophysical Union, Washington, DC), 91:222–247. 18. Tivey MK (2007) Generation of seafloor hydrothermal vent fluids and associated mineral deposits. Oceanography (Washington DC) 20(1):50–65. 19. Shank TM, et al. (1998) Temporal and spatial patterns of biological community development at nascent deep-sea hydrothermal vents (9°50’N, East Pacific Rise). Deep Sea Research Part II: Topical Studies in Oceanography 45(1–3):465–515. 20. Hessler RR, et al. (1988) Temporal change in megafauna at the Rose Garden hydrothermal vent (Galapagos Rift; eastern tropical Pacific). Deep Sea Research Part A: Oceanographic Research Papers 35(10–11):1681–1709.

Statistical Analyses. Comparisons of the symbiont composition of Alviniconcha individuals at different vent fields and among the four host types was assessed via ANOSIM using Bray–Curtis dissimilarity (88) (see SI Methods for details of ANOSIM). In these analyses, the symbiont composition for each individual represented an independent community profile. Additionally, the collections were compared by classifying each individual based on its dominant symbiont phylotype (γ-1, γ-Lau, ε, or γ-Both for the few individuals that hosted relatively equal proportions of the two γ-proteobacterial symbionts). In these analyses, Bray–Curtis dissimilarity from standardized collection profiles was used. One-way ANOVAs with post hoc pairwise comparisons (Tukey’s) were performed (SPSS Statistics v19) to compare the average carbon-stable isotope values among individuals from the same vent field (Tu’i Malila) with different dominant γ-proteobacterial symbiont phylotypes. To compare the temperature and environmental sulfide and oxygen concentrations among the collections at all sites as measured via cyclic voltammetry, a nonparametric test (Mann–Whitney U; SPSS Statistics v19) was used. ACKNOWLEDGMENTS. We thank E. Podowski and S. Hourdez for extensive assistance in the laboratory and on board ship; T. Yu and T. Galyean for preparing samples for stable isotopic analysis; K. Fontenaz for help with phylogenetic analysis; and the crews of the R/V Thomas G. Thompson, R/V Melville, and the ROV Jason II. This paper is based on work supported by National Science Foundation Grants OCE-0732369 (to P.R.G.), OCE-0732333 (to C.R.F.), OCE-1038124 and OCE-0241796 (to J.S.S.), and OCE-0732439 (to G.W.L.) under Graduate Research Fellowship DGE-1144152 (to R.A.B. and J.G.S.). J.S.S. also received support from the Woods Hole Oceanographic Institution. B.F. was supported by a Lavoisier Research Fellowship from the French Ministry of Foreign and European Affairs.
21. Fisher CR, et al. (1988) Microhabitat variation in the hydrothermal vent mussel, Bathymodiolus thermophilus, at the Rose Garden vent on the Galapagos Rift. Deep Sea Research Part A: Oceanographic Research Papers 35(10–11):1769–1791. 22. Waite TJ, et al. (2008) Variation in sulfur speciation with shellfish presence at a Lau Basin diffuse flow vent site. Journal of Shellfish Research 27(1):163–168. 23. Luther GW, 3rd, et al. (2001) Chemical speciation drives hydrothermal vent ecology. Nature 410(6830):813–816. 24. Moore TS, Shank TM, Nuzzio DB, Luther GW III (2009) Time-series chemical and temperature habitat characterization of diffuse flow hydrothermal sites at 9°50’N East Pacific Rise. Deep Sea Research Part II: Topical Studies in Oceanography 56(19–20): 1616–1621. 25. Fisher CR, et al. (1988) Variation in the hydrothermal vent clam, Calyptogena magnifica, at the Rose Garden vent on the Galapagos spreading center. Deep Sea Research Part A: Oceanographic Research Papers 35(10-11):1811–1831. 26. Le Bris N, Govenar B, Le Gall C, Fisher CR (2006) Variability of physico-chemical conditions in 9°50’N EPR diffuse flow vent habitats. Marine Chemistry 98(2–4):167–182. 27. Le Bris N, Sarradin PM, Caprais JC (2003) Contrasted sulphide chemistries in the environment of 13°N EPR vent fauna. Deep Sea Research Part I: Oceanographic Research Papers 50(6):737–747. 28. Podowski EL, Ma S, Luther GW III, Wardrop D, Fisher CR (2010) Biotic and abiotic factors affecting distributions of megafauna in diffuse flow on andesite and basalt along the Eastern Lau Spreading Center, Tonga. Marine Ecology Progress Series 418: 25–45. 29. Podowski EL, Moore TS, Zelnio KA, Luther GW, Fisher CR (2009) Distribution of diffuse flow megafauna in two sites on the Eastern Lau Spreading Center, Tonga. Deep-Sea Research Part I: Oceanographic Research Papers 56(11):2041–2056. 30. Girguis PR, Childress JJ (2006) Metabolite uptake, stoichiometry and chemoautotrophic function of the hydrothermal vent tubeworm Riftia pachyptila: Responses to environmental variations in substrate concentrations and temperature. Journal of Experimental Biology 209(Pt 18):3516–3528. 31. Cavanaugh CM, McKiness ZP, Newton ILG, Stewart FJ (2007) Marine Chemosynthetic Symbioses. The Prokaryotes, eds Dworkin M, Falkow S, Rosenberg E, Schleifer K-H, Stackebrandt E (Springer, New York), pp 475–507. 32. Petersen JM, et al. (2011) Hydrogen is an energy source for hydrothermal vent symbioses. Nature 476(7359):176–180. 33. Kleiner M, et al. (2012) Metaproteomics of a gutless marine worm and its symbiotic microbial community reveal unusual pathways for carbon and energy use. Proc Natl Acad Sci 109(19):E1173–E1182. 34. Denis F, Jollivet D, Moraga D (1993) Genetic separation of two allopatric populations of hydrothermal snails Alviniconcha spp (Gastropoda) from two south western pacific back-arc basins. Biochemical Systematics and Ecology 21(4):431–440. 35. Kojima S, et al. (2001) Phylogeny of hydrothermal-vent-endemic gastropods Alviniconcha spp. from the western Pacific revealed by mitochondrial DNA sequences. The Biological Bulletin 200(3):298–304. 36. Suzuki Y, et al. (2005) Novel chemoautotrophic endosymbiosis between a member of the Epsilonproteobacteria and the hydrothermal-vent gastropod Alviniconcha aff. hessleri (Gastropoda: Provannidae) from the Indian Ocean. Appl Environ Microbiol 71 (9):5440–5450. 37. Suzuki Y, et al. (2005) Molecular phylogenetic and isotopic evidence of two lineages of chemoautotrophic endosymbionts distinct at the subdivision level harbored in one

Beinart et al.

PNAS Early Edition | 9 of 10

ECOLOGY

PNAS PLUS

! ! ! !
22

!

host-animal type: The genus Alviniconcha (Gastropoda: Provannidae). FEMS Microbiol Lett 249(1):105–112. 38. Suzuki Y, et al. (2006) Host-symbiont relationships in hydrothermal vent gastropods of the genus Alviniconcha from the Southwest Pacific. Appl Environ Microbiol 72(2): 1388–1393. 39. Stein JL, et al. (1988) Chemoautotrophic symbiosis in a hydrothermal vent gastropod. The Biological Bulletin 174(3):373–378. 40. Urakawa H, et al. (2005) Hydrothermal vent gastropods from the same family (Provannidae) harbour epsilon- and gamma-proteobacterial endosymbionts. Environ Microbiol 7(5):750–754. 41. Martinez F, Taylor B, Baker ET, Resing JA, Walker SL (2006) Opposing trends in crustal thickness and spreading rate along the back-arc Eastern Lau Spreading Center: Implications for controls on ridge morphology, faulting, and hydrothermal activity. Earth and Planetary Science Letters 245(3–4):655–672. 42. Bézos A, Escrig S, Langmuir CH, Michael PJ, Asimow PD (2009) Origins of chemical diversity of back-arc basin basalts: A segment-scale study of the Eastern Lau Spreading Center. Journal of Geophysical Research 114(B6):B06212. 43. Escrig S, Bézos A, Goldstein SL, Langmuir CH, Michael PJ (2009) Mantle source variations beneath the Eastern Lau Spreading Center and the nature of subduction components in the Lau basin-Tonga arc system. Geochemistry Geophysics Geosystems 10(4):Q04014. 44. Mottl MJ, et al. (2011) Chemistry of hot springs along the Eastern Lau Spreading Center. Geochimica Et Cosmochimica Acta 75:1013–1038. 45. Hsu-Kim H, Mullaugh KM, Tsang JJ, Yucel M, Luther GW, 3rd (2008) Formation of Znand Fe-sulfides near hydrothermal vents at the Eastern Lau Spreading Center: Implications for sulfide bioavailability to chemoautotrophs. Geochem Trans 9(1):6. 46. Distel DL, Lee HK, Cavanaugh CM (1995) Intracellular coexistence of methano- and thioautotrophic bacteria in a hydrothermal vent mussel. Proc Natl Acad Sci USA 92(21):9598–9602. 47. Duperron S, et al. (2006) A dual symbiosis shared by two mussel species, Bathymodiolus azoricus and Bathymodiolus puteoserpentis (Bivalvia: Mytilidae), from hydrothermal vents along the northern Mid-Atlantic Ridge. Environ Microbiol 8(8): 1441–1447. 48. DeChaine EG, Cavanaugh CM (2006) Symbioses of Methanotrophs and Deep-Sea Mussels (Mytilidae: Bathymodiolinae). Molecular Basis of Symbiosis. Progress in Molecular and Subcellular Biology, ed Overmann J (Springer, Berlin), 41:227–249. 49. Endow K, Ohta S (1989) The symbiotic relationship between bacteria and a mesogastropod snail, Alviniconcha hessleri, collected from hydrothermal vents of the Mariana back-arc basin. Bulletin of the Japanese Society of Microbial Ecology 3(2): 73–82. 50. Vrijenhoek RC (2010) Genetic diversity and connectivity of deep-sea hydrothermal vent metapopulations. Mol Ecol 19(20):4391–4411. 51. Cowen RK, Sponaugle S (2009) Larval dispersal and marine population connectivity. Annu Rev Mar Sci 1(1):443–466. 52. Waren A, Bouchet P (1993) New records, species, genera, and a new family of gastropods from hydrothermal vents and hydrocarbon seeps. Zoologica Scripta 22(1):1–90. 53. Speer K, Thurnherr AM (2012) The Lau Basin float experiment (LAUB-FLEX). Oceanography (Washington DC) 25(1):284–285. 54. Martinez F, Taylor B (2002) Mantle wedge control on back-arc crustal accretion. Nature 416(6879):417–420. 55. Taylor B, Martinez F (2003) Back-arc basin basalt systematics. Earth and Planetary Science Letters 210(3-4):481–497. 56. Dunn RA, Martinez F (2011) Contrasting crustal production and rapid mantle transitions beneath back-arc ridges. Nature 469(7329):198–202. 57. Proskurowski G, Lilley MD, Olson EJ (2008) Stable isotopic evidence in support of active microbial methane cycling in low-temperature diffuse flow vents at 9°50’N East Pacific Rise. Geochimica Et Cosmochimica Acta 72(8):2005–2023. 58. Butterfield DA, Massoth GJ (1994) Geochemistry of north Cleft segment vent fluids: Temporal changes in chlorinity and their possible relation to recent volcanism. Journal of Geophysical Research 99(B3):4951–4968. 59. Butterfield DA, et al. (1997) Seafloor eruptions and evolution of hydrothermal fluid chemistry. Philosophical Transactions of the Royal Society of London. Series A: Mathematical, Physical and Engineering Sciences 355(1723):369–386. 60. Yamamoto M, Takai K (2011) Sulfur metabolisms in epsilon- and gammaProteobacteria in deep-sea hydrothermal fields. Frontiers in Microbiology, 10.3389/ fmicb.2011.00192. 61. Nakagawa S, Takai K (2008) Deep-sea vent chemoautotrophs: Diversity, biochemistry and ecological significance. FEMS Microbiol Ecol 65(1):1–14. 62. Macalady JL, et al. (2008) Niche differentiation among sulfur-oxidizing bacterial populations in cave waters. ISME J 2(6):590–601. 63. Campbell BJ, Engel AS, Porter ML, Takai K (2006) The versatile epsilon-proteobacteria: Key players in sulphidic habitats. Nat Rev Microbiol 4(6):458–468.

64. Nakagawa S, et al. (2005) Distribution, phylogenetic diversity and physiological characteristics of epsilon-Proteobacteria in a deep-sea hydrothermal field. Environ Microbiol 7(10):1619–1632. 65. Nakagawa S, Takaki Y (2001) Nonpathogenic Epsilonproteobacteria (John Wiley and Sons, Ltd, Chichester). Available at http://www.els.net. 66. Henry MS, Childress JJ, Figueroa D (2008) Metabolic rates and thermal tolerances of chemoautotrophic symbioses from Lau Basin hydrothermal vents and their implications for species distributions. Deep-Sea Research Part I: Oceanographic Research Papers 55(5):679–695. 67. Wittenberg JB, Stein JL (1995) Hemoglobin in the symbiont-harboring gill of the marine gastropod Alviniconcha hessleri. The Biological Bulletin 188(1):5–7. 68. Matabos M, Le Bris N, Pendlebury S, Thiebaut E (2008) Role of physico-chemical environment on gastropod assemblages at hydrothermal vents on the East Pacific Rise (13°N/EPR). Journal of the Marine Biological Association of the United Kingdom 88(05):995–1008. 69. Thornhill DJ, Kemp DW, Bruns BU, Fitt WK, Schmidt GW (2008) Correspondence between cold tolerance and temperatre biogeography in a western Atlantic Symbiodinium (Dinophyta) lineage. Journal of Phycology 44(5):1126–1135. 70. Verde E, McCloskey L (2007) A comparative analysis of the photobiology of zooxanthellae and zoochlorellae symbiotic with the temperate clonal anemone Anthopleura elegantissima (Brandt). III. Seasonal effects of natural light and temperature on photosynthesis and respiration. Marine Biology 152(4):775–792. 71. Iglesias-Prieto R, Beltrán VH, LaJeunesse TC, Reyes-Bonilla H, Thomé PE (2004) Different algal symbionts explain the vertical distribution of dominant reef corals in the eastern Pacific. Proc Biol Sci 271(1549):1757–1763. 72. Loram JE, Trapido-Rosenthal HG, Douglas AE (2007) Functional significance of genetically different symbiotic algae Symbiodinium in a coral reef symbiosis. Mol Ecol 16(22):4849–4857. 73. Bongaerts P, et al. (2010) Genetic divergence across habitats in the widespread coral Seriatopora hystrix and its associated Symbiodinium. PLoS ONE 5(5):e10871. 74. Finney JC, et al. (2010) The relative significance of host-habitat, depth, and geography on the ecology, endemism, and speciation of coral endosymbionts in the genus Symbiodinium. Microb Ecol 60(1):250–263. 75. Ferrari J, et al. (2004) Linking the bacterial community in pea aphids with host-plant use and natural enemy resistance. Ecol Entomol 29(1):60–65. 76. Ferrari J, Scarborough CL, Godfray HC (2007) Genetic variation in the effect of a facultative symbiont on host-plant use by pea aphids. Oecologia 153(2):323–329. 77. Tsuchida T, Koga R, Shibao H, Matsumoto T, Fukatsu T (2002) Diversity and geographic distribution of secondary endosymbiotic bacteria in natural populations of the pea aphid, Acyrthosiphon pisum. Mol Ecol 11(10):2123–2135. 78. Halary S, Riou V, Gaill F, Boudier T, Duperron S (2008) 3D FISH for the quantification of methane- and sulphur-oxidizing endosymbionts in bacteriocytes of the hydrothermal vent mussel Bathymodiolus azoricus. ISME J 2(3):284–292. 79. Riou V, et al. (2008) Influence of CH4 and H2S availability on symbiont distribution, carbon assimilation and transfer in the dual symbiotic vent mussel Bathymodiolus azoricus. Biogeosciences 5(6):1681–1691. 80. Fujiwara Y, et al. (2000) Phylogenetic characterization of endosymbionts in three hydrothermal vent mussels: Influence on host distributions. Marine Ecology Progress Series 208:147–155. 81. Van Dover CL (2002) Community structure of mussel beds at deep-sea hydrothermal vents. Marine Ecology Progress Series 230:137–158. 82. Cordes EE, Becker EL, Hourdez S, Fisher CR (2010) Influence of foundation species, depth, and location on diversity and community composition at Gulf of Mexico lowerslope cold seeps. Deep Sea Research Part II: Topical Studies in Oceanography 57(21– 23):1870–1881. 83. Luther GW III, et al. (2008) Use of voltammetric solid-state (micro)electrodes for studying biogeochemical processes: Laboratory measurements to real time measurements with an in situ electrochemical analyzer (ISEA). Marine Chemistry 108(3–4):221–235. 84. Gartman A, et al. (2011) Sulfide oxidation across diffuse flow zones of hydrothermal vents. Aquatic Geochemistry 17(4):583–601. 85. Seewald JS, Doherty KW, Hammar TR, Liberatore SP (2002) A new gas-tight isobaric sampler for hydrothermal fluids. Deep Sea Research Part I: Oceanographic Research Papers 49(1):189–196. 86. Shapiro B, Rambaut A, Drummond AJ (2006) Choosing appropriate substitution models for the phylogenetic analysis of protein-coding sequences. Mol Biol Evol 23(1): 7–9. 87. Drummond AJ, Rambaut A (2007) BEAST: Bayesian evolutionary analysis by sampling trees. Australian Journal of Ecology 7(1):214. 88. Clarke KR (1993) Non-parametric multivariate analyses of changes in community structure. Australian Journal of Ecology 18(1):117–143.

10 of 10 | www.pnas.org/cgi/doi/10.1073/pnas.1202690109

Beinart et al.

! ! ! !
23

!

! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! !

Chapter 3 Metatranscriptomics reveal differences in in situ energy and nitrogen metabolism among hydrothermal vent snail symbionts

(as published in The International Society for Microbial Ecology Journal)

The ISME Journal (2013) 7, 1556–1567
& 2013 International Society for Microbial Ecology All rights reserved 1751-7362/13 www.nature.com/ismej

OPEN

ORIGINAL ARTICLE

Metatranscriptomics reveal differences in in situ energy and nitrogen metabolism among hydrothermal vent snail symbionts
JG Sanders1,4, RA Beinart1,4, FJ Stewart2, EF Delong3 and PR Girguis1
1

Department of Organismic and Evolutionary Biology, Harvard University, Cambridge, MA, USA; 2School of Biology, Georgia Institute of Technology, Atlanta, GA, USA and 3Parsons Laboratory, Massachusetts Institute of Technology, Civil and Environmental Engineering, Cambridge, MA, USA

Despite the ubiquity of chemoautotrophic symbioses at hydrothermal vents, our understanding of the influence of environmental chemistry on symbiont metabolism is limited. Transcriptomic analyses are useful for linking physiological poise to environmental conditions, but recovering samples from the deep sea is challenging, as the long recovery times can change expression profiles before preservation. Here, we present a novel, in situ RNA sampling and preservation device, which we used to compare the symbiont metatranscriptomes associated with Alviniconcha, a genus of vent snail, in which specific host–symbiont combinations are predictably distributed across a regional geochemical gradient. Metatranscriptomes of these symbionts reveal key differences in energy and nitrogen metabolism relating to both environmental chemistry (that is, the relative expression of genes) and symbiont phylogeny (that is, the specific pathways employed). Unexpectedly, dramatic differences in expression of transposases and flagellar genes suggest that different symbiont types may also have distinct life histories. These data further our understanding of these symbionts’ metabolic capabilities and their expression in situ, and suggest an important role for symbionts in mediating their hosts’ interaction with regional-scale differences in geochemistry. The ISME Journal (2013) 7, 1556–1567; doi:10.1038/ismej.2013.45; published online 25 April 2013 Subject Category: Microbe-microbe and microbe-host interactions Keywords: symbiosis; hydrothermal vents; metatranscriptomics; chemoautotrophy; Alviniconcha

Introduction
Endosymbioses among marine invertebrates and chemoautotrophic bacteria have a key role in the ecology and biogeochemistry of deep-sea hydrothermal vents and similar environments. Symbionts derive energy by oxidizing reduced compounds (for example, sulfide, methane, hydrogen) and fix inorganic carbon, providing nutrition to their hosts (Felbeck, 1981; Fisher and Childress, 1984; Childress et al., 1986, 1991; Girguis and Childress, 2006; Petersen et al., 2011). Much is known about host biochemical and morphological adaptations to both their symbionts and the environment (reviewed in Stewart et al., 2005; Childress and Girguis, 2011). Surprisingly less, however, is known about the relationship between symbiont physiology and the environment, in particular how variations in
Correspondence: PR Girguis, Department of Organismic and Evolutionary Biology, Harvard University, 16 Divinity Avenue, Biolabs Rm 3085, Cambridge, MA 02138, USA. E-mail: pgirguis@oeb.harvard.edu 4 These authors contributed equally to this work. Received 24 September 2012; revised 31 January 2013; accepted 11 February 2013; published online 25 April 2013

environmental geochemistry influence symbiont metabolic activity and, in turn, how this affects the ecology of the animal–microbe association. The symbioses between the deep-sea snail Alviniconcha and its chemoautotrophic symbionts afford a unique opportunity to examine these relationships. Alviniconcha are provannid gastropods that are indigenous to vents in the Western Pacific and Indian Ocean and harbor chemoautotrophic symbionts within host cells located in the gill (Suzuki et al., 2006). At the Eastern Lau Spreading Center in the southwestern Pacific (ELSC, Supplementary Figure S1), genetically distinct Alviniconcha ‘types’ (likely cryptic species) form associations with three lineages of chemoautotrophic Proteobacteria: two g-proteobacteria (termed g-1 and g-Lau) and an e-proteobacterium (Beinart et al., 2012). A recent study of these host-symbiont associations (hereafter referred to as holobionts), found striking patterns of distribution along the B300 km length of the ELSC, wherein snails hosting e-proteobacteria dominated the northern vent fields and those hosting g-proteobacteria dominated the southern fields (Beinart et al., 2012). Vent fluids also showed marked changes in geochemistry along this range,

!

!

!

25

Metatranscriptomes of vent snail symbionts JG Sanders and RA Beinart et al 1557

with substantially elevated hydrogen and hydrogen sulfide concentrations in the northernmost fields (Mottl et al., 2011; Beinart et al., 2012). This unprecedented pattern of holobiont distribution across this 300 km spreading center suggests a link between symbiont physiology and the environment; namely that differences in the availability of reduced compounds may influence the realized niche of the holobionts as a function of their symbionts’ metabolic capacity. Our understanding of these observed patterns would be facilitated by analyses that reveal the symbionts’ physiological poise in situ. Transcriptomic studies have been used to relate changes in gene expression to environmental conditions (Gracey, 2007; Gracey et al., 2008). Previous studies have also used transcriptomics to study gene expression in both host and chemoautotrophic symbionts (Harada et al., 2009; Stewart et al., 2011; Wendeberg et al., 2012). However, using transcriptomics to study patterns of gene expression in the deep sea (that is, in situ) is especially challenging. Organisms are typically held in ambient seawater during sampling and recovery, so their transcriptional profiles likely change in the hours between collection and preservation (Wendeberg et al., 2012). To better examine the relationship between Alviniconcha symbiont physiology and the observed regional-scale differences in geochemistry, we developed a novel in situ sampling and preservation system that allowed us to quickly homogenize and preserve holobionts at the seafloor, simultaneously stopping transcription and stabilizing nucleic acids for downstream analysis. Using this device, we collected individual Alviniconcha from four vent fields spanning the previously observed geochemical gradient along the ELSC. Gene expression analyses revealed key differences among symbiont types in the expression of genes relating to hydrogen and sulfur oxidation. In contrast, similarities in patterns of gene expression relating to nitrogen metabolism—which deviate from canonical models of nitrate reduction—suggest a potentially unique strategy of nitrogen utilization that is shared among these symbionts. We also observed differences in gene expression that may be relevant to the maintenance and transmission of these associations. Our results clearly illustrate differences in physiological poise among these symbiont types, underscore the likely role of symbiont physiology in structuring holobiont distribution, and provide insights into how these phylogenetically distinct symbionts have evolved to exploit resources and niches in these highly dynamic environments.

Mussel And Snail Homogenizer (ISMASH; Figures 1a and b). The ISMASH consists of a 1 l stainless steel blending cylinder, the bottom of which contains a rotating blade assembly and preservative inlet. The top is open to permit sample insertion but is sealed post-collection via a magnetically-latched lid equipped with a one-way check valve. The ISMASH can be operated at any depth attainable by the submersible. During operations, the ISMASH is deployed open and empty on the submersible’s working platform. When individual specimens are deposited in the cylinder, the operator places the magnetic lid on the cylinder, and RNALater (Ambion Inc., Grand Island, NY, USA) is pumped in from the bottom, displacing the less-dense seawater through the lid’s check valve. After pumping sufficient RNALater to ensure thorough flushing, a hydraulic motor actuates the blade assembly and the sample is homogenized. For a complete instrument description and operational procedures, see Supplementary Information.
Sample collection

Alviniconcha holobionts (Figure 1c) were collected along the ELSC using the ROV Jason II aboard the R/V Thomas G Thompson during expedition TM-235 in 2009. One snail was collected randomly from among large aggregations at each of the four vent fields (Kilo Moana and Tow Cam in the north, ABE and Tu’i Malila in the south; Table 1, Supplementary Figure S1), then homogenized in situ. Time limitations prohibited additional sampling. Homogenization was completed within 4–10 min of collection. Upon recovery, the B1 l homogenates were carefully transferred to sterile glass jars, incubated overnight at 4 1C, and then frozen and maintained at À 201 for B5 months before extraction.
Nucleic acid extraction, library preparation, and sequencing

Materials and methods
Instrument design

To preserve holobiont RNA in situ, we designed a sample container/homogenizer termed the In Situ

Before extraction, homogenates were thawed and rehomogenized in a clean, sterile blender (Waring Inc., Torrington, CT, USA) to maximize uniformity. One 2-ml aliquot was taken from each sample and centrifuged at 14 000 Â g for 10 min in a refrigerated centrifuge. RNA was extracted from the pellet using TRIzol (Invitrogen Inc., Grand Island, NY, USA) per the manufacturer’s protocol. After each extraction, RNA was assessed with an Agilent 2100 Bioanalyzer (Santa Clara, CA, USA) to determine concentration and integrity. To maximize mRNA representation in our metatranscriptomic libraries, we preferentially removed eukaryotic and bacterial ribosomal RNA (rRNA) using sample-specific rRNA probes as in Stewart et al. (2010). Each of the four libraries was sequenced in a separate, gasketed quadrant using Titanium chemistry, yielding a full plate on a
The ISME Journal

!

!

!

26

Metatranscriptomes of vent snail symbionts JG Sanders and RA Beinart et al 1558

Figure 1 The In Situ Mussel and Snail Homogenizer (ISMASH). Cutaway schematic of the ISMASH design (a) and a photograph of the ROV JASON II manipulator arm depositing an Alviniconcha into the ISMASH body (b), with parts labeled: po, preservative outlet; l, magnetic sealing acrylic lid; mg, magnets; b, blender body; bl, blade assembly; pi, preservative inlet; mt, motor; c, chassis; j, ROV JASON II manipulator arm; A, Alviniconcha. An Alviniconcha snail, photograph taken shipboard (c).

Table 1 Sample information for each metatranscriptome: vent field, collection details, and host and symbiont type
Vent field Kilo Moana Tow Cam ABE Tu’i Malila Dive J2-433 J2-432 J2-431 J2-430 Date, time (GMT) 6/6/2009, 6/5/2009, 6/3/2009, 6/2/2009, 05:49 11:58 14:29 09:50 Latitude, longitude 20 03.227 S, 176 8.008 W 20 18.973 S, 176 8.195 W 20 45.794 S, 176 11.478 W 21 59.363 S, 176 34.105 W Depth (m) 2615 2722 2146 1869 Host type (accession) HT-II (JX134579) HT-II (JX134578) HT-I (JX134580) HT-III (JX134581) Symbiont type e e g-1 g-1/ g-Lau

Roche Genome Sequencer FLX (Roche Inc., Basel, Switzerland). DNA was extracted from an additional 2 ml aliquot per sample using a DNeasy Blood & Tissue kit (Qiagen Inc., Venlo, Netherlands) per the manufacturer’s protocol. DNA samples were used to assess host and symbiont identities, as well as microbial diversity (while the gill endosymbionts are typically monocultures, our technique would also include any epibionts or other microbes associated with the snail). We confirmed host genotypes by sequencing 500 bp of the mitochondrial cytochrome oxidase I gene (as in Beinart et al., 2012; Table 1). The identity and abundances of the major symbiont types were assessed using SYBR Green qPCR assays on a Mx3005P realtime thermal cycler (Stratagene Inc., Santa Clara, CA, USA), using previously described primers and protocols (Beinart et al., 2012). Microbial diversity was assessed via pyrosequencing of the V1–V3 region of the bacterial 16S rRNA gene (Dowd et al., 2008).
Metatranscriptomic analyses

Sequences were filtered of rRNA sequences using BLASTN (cutoff bit score ¼ 50) against a custom
The ISME Journal

database of rRNA sequences derived from the SILVA LSU and SSU databases and microbial genomes (Pruesse et al., 2007). Non-rRNA reads were further filtered for potentially artifactual duplicate sequences (reads of equal length sharing 100% sequence identity) using custom scripts as in the study of Gomez-Alvarez et al. (2009). The remaining reads were annotated using BLASTX against the NCBI nr database (as of 28 April 2011; bit score cutoff ¼ 50). BLASTX results were examined for taxonomic representation, gene content, and functional pathways in MEGAN4 (Huson et al., 2011). Given the representation of both host and symbiont sequences in the libraries, we analyzed reads annotated as eukaryotic or bacterial separately. Each sample’s eukaryotic and bacterial transcriptomes were normalized to the total number of non-rRNA reads assigned to their respective taxonomic division in MEGAN. Reads not assigned a division-level taxonomic identification were excluded from further analysis. To validate the results from MEGAN, we submitted our entire raw transcriptomic data set and, separately, the fraction of non-rRNA reads identified as bacterial in origin to MG-RAST (Meyer et al.,

!

!

!

27

Metatranscriptomes of vent snail symbionts JG Sanders and RA Beinart et al 1559

Table 2 Metatranscriptome sequence characteristics
Kilo Moana Tow Cam ABE Tu’i Malila

Total reads 199 679 165 105 182 311 171 587 rRNA reads 102 675 83 436 67 669 135 141 Non-rRNA reads 97 004 81 669 114 642 36 446 Taxon-assigned 35 497 35 763 48 666 17 408 proteins % Eukaryotic 71% 60% 58% 37% (MG-RAST accn.) (4492532.3) (4492531.3) (4492530.3) (4492529.3) % Bacterial 27% 38% 39% 59% (MG-RAST accn.) (4491348.3) (4491346.3) (4491347.3) (4491344.3) % g-1a (16S) 0/0% 0/0% 87/98% 33/48% 0/0% 0/0% 0/0% 59/51% % g-Laua (16S) % ea (16S) 84/100% 98/100% 0/2% 0/1%
a Proportion of symbiont 16S rRNA gene copies in ISMASH DNA as determined via 454 pyrosequencing/quantitative PCR.

2008). There was broad agreement between results derived from MEGAN and those from MG-RAST. Unless otherwise specified, all described results are derived from manual searches of the bacterial data sets with SEED/Subsystems annotations in MG-RAST (e-value ¼ 10 À 4). All eight datasets are now publicly available on MG-RAST (Table 2). Bacterial 16S rRNA gene diversity from amplicon pyrosequencing was assessed in QIIME v1.4.0 (Caporaso et al., 2010). Raw pyrosequencing flowgrams were denoised using the QIIME Denoiser (Reeder and Knight, 2010), then sequences were filtered for chimeras using the de novo implementation of the UCHIME chimera checker (Edgar et al., 2011). Sequences were then clustered at 97% identity using UCLUST (Edgar, 2010), and the resulting operational taxonomic units were analyzed using the default QIIME pipeline.

Results and discussion
Transcriptome characteristics and taxonomic composition

The ISMASH was highly effective at preserving RNA in situ. Assessments of extracted RNA showed good preservation, with clearly defined eukaryotic and prokaryotic rRNA peaks (Supplementary Figure S2). Rapid in situ homogenization likely facilitated the penetration of preservative throughout the tissues of these large-shelled organisms. More importantly, in situ homogenization arrests metabolism and alleviates concerns about transcriptional changes that might arise if specimens are simply submerged in a preservative in situ, or are recovered in seawater and preserved on board ship. Between 160 000 and 200 000 metatranscriptomic reads were recovered from each sample (Table 2). Of these, 37–79% matched the rRNA database. Between 10–27% of the total reads (17 000 and 49 000) matched to protein-coding genes in the NCBI nr database. In total, we recovered between 9450 and 18 915 putatively bacterial and between 6434 and 28 412 putatively eukaryotic protein-coding

transcripts per sample. Approximately 50–60% of transcripts identified as bacterial in origin were successfully assigned a functional annotation, compared with just 12–13% of eukaryotic transcripts. Consistent with our objective of examining symbiont gene expression, subsequent analyses focused solely on genes of bacterial origin. Expression data presented hereafter are normalized to the total number of protein-coding transcripts assigned to bacteria in each sample, and scaled to represent a 10 000 read library. Host genotyping and assessment of the symbiont compositions from DNA extracts demonstrated that the distribution of sampled holobionts along the spreading center—as well as the observed specificity among host and symbiont types—was concordant with previous results (Beinart et al., 2012). Partial Alviniconcha mitochondrial cytochrome oxidase I gene sequences showed that all four sampled snails had X99% identity to genotypes previously described from the ELSC (Table 1). Taxonomic assignment of bacterial 16S rRNA genes amplified from DNA extracts revealed that 84–98% of bacteria in each sample matched Alviniconcha symbiont reference sequences, with the most abundant operational taxonomic units in each sample matching reference sequences at 99–100% identity (Table 2). e-proteobacterial symbionts dominated the host type II samples from the two northern fields (Kilo Moana and Tow Cam), and g-proteobacterial symbionts dominated the host type I and type III samples from the two southern fields (ABE and Tu’i Malila, respectively). Though three of the four samples were dominated by a single symbiont phylotype, the Tu’i Malila sample appeared to simultaneously host both g-1 and g-Lau phylotypes (Table 2). To help confirm that the overall taxonomic composition of the data set was reflected in key metabolic pathways, taxonomic assignments for genes involved in sulfur metabolism, hydrogen oxidation, and nitrogen metabolism were manually reviewed in MEGAN (Supplementary Table S1). Despite the uncertainties associated with taxonomy assignment to individual short reads, there was very little evidence for expression of e-proteobacterial transcripts in g-dominated samples, or vice versa.
Sulfur metabolism

Sulfur oxidation genes were well represented in all metatranscriptomes, constituting 2–3% of the total bacterial transcripts in each sample (Figure 2, Supplementary Table S1). The g-dominated samples showed expression of sulfur oxidation genes and pathways typical of chemoautotrophic g-proteobacteria (Figure 3, Supplementary Table S1). From both g-dominated samples, we recovered transcripts from the core periplasmic Sox genes, soxXYZ, though not the soxCD genes. The Sox complex without SoxCD is utilized for the incomplete
The ISME Journal

!

!

28

Metatranscriptomes of vent snail symbionts JG Sanders and RA Beinart et al 1560

oxidation of sulfide or thiosulfate, resulting in the deposition of periplasmic elemental sulfur granules (Grimm et al., 2008; Ghosh and Dam, 2009). The

g-dominated metatranscriptomes also contained transcripts for sulfide:quinone (oxido)reductases (Sqr) and sulfide dehydrogenases (Fcc), which

Figure 2 Summarized differences in expression of the most abundant categories of symbiont genes. Only gene categories with membership comprising 40.5% of the total data set are represented. Blue- and yellow-shaded bars indicate relative levels of expression in g- or e-dominated metatranscriptomes, respectively, on a linear scale. Dark gray bars indicate the base-10 logarithm of the odds ratio ((Gg/Tg)/(Ge/Te), where G ¼ no. reads in that category and T ¼ total no. of reads). Positive log (odds ratios) indicate genes more likely to be expressed in g-dominated metatranscriptomes (‘Protein biosynthesis’ abundance and ‘Sulfate reduction’ log ratio bars exceed the axis limits in the figure at the scale presented). Genes are summarized by the Level 2 of the SEED Subsystems ontology as annotated in MEGAN4.
The ISME Journal

!

!

29

Metatranscriptomes of vent snail symbionts JG Sanders and RA Beinart et al 1561

Figure 3 Energy metabolism pathways and levels of expression in g- and e-dominated metatranscriptomes. (a) Relative abundance of genes involved in sulfur oxidation, hydrogen oxidation, nitrogen reduction and assimilation, and aerobic respiration. Circle area reflects total normalized expression for each gene category for g- or e-dominated metatranscriptomes, respectively. Circles are divided according to relative contribution of each individual sample. e-dominated metatranscriptomes are shaded yellow, while g-dominated metatranscriptomes are shaded blue. (b) Energy metabolism models for g- and e-proteobacterial symbionts represented in a stylized cell. The upper, yellow half shows the model for e-symbionts, while the blue lower half shows the model for g-symbionts. Proteins and complexes are colored by metabolic category: yellow ¼ sulfur metabolism; white ¼ aerobic respiration; green ¼ nitrogen metabolism; blue ¼ hydrogen oxidation. Arrows show general direction of electron flux. Sox, Sox multienzyme complex; rDsr, reverse dissimilatory sulfur reduction pathway; Apr, adenylylsulfate reductase; Sat, sulfur adenylyltransferase; Sdh, sulfite dehydrogenase; Sqr, sulfide quinone (oxido)reductase; Psr, polysulfide reductase; Hyd, hydrogenase; Nap, periplasmic nitrate reductase; NarK, nitrate/nitrite transporter; NirA, ferredoxin-dependent nitrite reductase; NirBD, NADH-dependent siroheme nitrite reductase; NirS, membrane-bound respiratory nitrite reductase; Nor, nitric oxide reductase; Nos, nitrous oxide reductase; GS þ GOGAT, glutamine synthetase þ glutamate synthase; Amm. Trans., ammonium transporter; Q, quinone; b/c1, cytochrome bc1; c, cytochrome c; CytCO, cytochrome c oxidase.

oxidize sulfide to elemental sulfur in the periplasm (Frigaard and Dahl, 2008; Ghosh and Dam, 2009). Consistent with the expression of these genes and pathways, we frequently observe elemental sulfur granules in the gills of Alviniconcha hosting g-proteobacteria. The further oxidation of this elemental sulfur to sulfate is thought to involve additional pathways (Ghosh and Dam, 2009), such as reverse dissimilatory sulfate reduction (rDSR). Indeed, the DSR genes dsrABCEFJKMLOPS were highly expressed in both g-dominated samples, with dsrFHR genes present in at least one g-dominated sample (dsrEFHR abundances determined via MG-RAST IMG annotation). The presence of dsrEFH transcripts indicates use of this pathway for the oxidation of reduced sulfur species. Here, the reverse DSR pathway is likely coupled to sulfite oxidation via an indirect pathway involving APS reductase

and sulfate adenylyltransferase, both of which were identified in the g-dominated metatranscriptomes. Notably, the expression of an incomplete Sox complex along with reverse DSR and indirect sulfite oxidation pathways is common among g-proteobacterial chemosynthetic endosymbionts (Harada et al., 2009; Markert et al., 2011; Stewart et al., 2011). We detected transcripts from both pathways in the metatranscriptome derived from a snail dominated by the g-1 phylotype, suggesting that both pathways are present and being expressed in this symbiont. However, as the other metatranscriptome was derived from a mixed symbiont community of two g-proteobacterial phylotypes, we cannot say whether these pathways are expressed by one or both of the g-proteobacterial symbionts. In contrast to the g-dominated metatranscriptomes, the e-dominated metatranscriptomes from
The ISME Journal

!

!

!

30

Metatranscriptomes of vent snail symbionts JG Sanders and RA Beinart et al 1562

the northern two vent fields lacked reverse DSR transcripts, but were replete with complete Sox– multienzyme complex and Sqr transcripts (Figure 3, Supplementary Table S1). The full Sox–multienzyme complex is employed by e-proteobacteria for the complete oxidation of sulfide, thiosulfate, and/or elemental sulfur (Yamamoto and Takai, 2011). Additionally, we detected high expression of sqr genes, despite the fact that the e-proteobacterial symbiont, like its free-living relatives from the genus Sulfurimonas, has not been observed to form visible sulfur granules (Sievert et al., 2008). Many e-proteobacterial genomes encode genes for Sqr in addition to the Sox complex, though the role of Sqr in sulfur oxidation and its relationship to the Sox pathway is still uncertain in these symbionts and other e-proteobacteria.
Hydrogen metabolism

Previous work has shown that Alviniconcha hosting e-proteobacterial symbionts dominate at the northern vent fields, where hydrogen concentrations are highest, suggesting that hydrogen might serve as an electron donor for these symbionts (Beinart et al., 2012). The metatranscriptomes from the two e-dominated, northernmost samples revealed the potential for respiratory hydrogen oxidation, with both samples expressing genes allied to Group 1 NiFe-hydrogenases (B0.5% of all transcripts, Figure 3 and Supplementary Table S1). This group of enzymes, often called uptake hydrogenases, are membrane-bound, respiratory enzymes that oxidize hydrogen and donate electrons to the quinone pool (Vignais and Billoud, 2007). Hydrogen oxidation transcripts for Group 1 NiFe-hydrogenases were also recovered—though with much lower representation—from the g-dominated metatranscriptomes (Figure 3).

The presence of hydrogenase transcripts in all four of the Alviniconcha metatranscriptomes indicates that hydrogen could be an electron donor in both the g- and e-proteobacterial symbionts of Alviniconcha. However, the difference in expression of hydrogenases between the e- and the g-dominated individuals suggests that hydrogen oxidation potentially has a larger role in the energy metabolism of the holobionts with e-proteobacteria (Figure 3, Supplementary Table S1). Phylogenetic analysis of the Alviniconcha e-proteobacterial endosymbionts from the ELSC shows that they are closely allied to members of the genus Sulfurimonas (Beinart et al., 2012), many of which are able to utilize both hydrogen and reduced sulfur compounds as electron donors (Nakagawa et al., 2005). A recent study employed a suite of molecular, physiological, and geochemical approaches to show that vent mussels with g-proteobacterial symbionts can oxidize hydrogen to support carbon fixation (Petersen et al., 2011). Future studies will use similar approaches to elucidate the degree to which these Alviniconcha e-proteobacterial endosymbionts rely on hydrogen for energy production.
Carbon fixation

Transcript representation and abundances revealed clear differences in carbon fixation pathways between g- and e-dominated individuals (Figure 4, Supplementary Table S1). Key genes of the CalvinBenson-Bassham cycle, including those encoding Form II Ribulose-1,5-bisphosphate carboxylase/oxygenase and phosphoribulokinase, were enriched in g-dominated metatranscriptomes. In contrast, the three key genes associated with the reductive tricarboxylic acid (rTCA) cycle (ATP citrate lyase, 2-oxoglutarate oxidoreductase, and fumarate reductase) were found only in snails hosting e-proteobacteria.

Figure 4 Summarized differences in expression of genes involved in carbon fixation, transposase and flagellar genes. Transcript abundance is normalized to 10 000 per sample.
The ISME Journal

!

!

!

31

Metatranscriptomes of vent snail symbionts JG Sanders and RA Beinart et al 1563

These patterns are consistent with previous studies of carbon fixation in both free-living and symbiotic chemoautotrophs of these two major bacterial groups (Hugler et al., 2005; Takai et al., 2005; Woyke et al., 2006; Nakagawa and Takai, 2008; Sievert et al., 2008; Hugler et al., 2011). Both the Calvin-Benson-Bassham ¨ cycle with Form II Ribulose-1,5-bisphosphate carboxylase/oxygenase and the reductive tricarboxylic acid cycle are typically associated with autotrophs from low-oxygen environments (Berg, 2011), suggesting that the symbionts of Alviniconcha are experiencing such conditions. This may be due to low environmental oxygen concentrations around Alviniconcha or limited provisioning to the symbionts by the snails’ oxygenbinding proteins hemocyanin and hemoglobin (Wittenberg and Stein, 1995).
Nitrogen metabolism

All organisms need nitrogen for growth and biosynthesis, requiring the assimilation of an exogenous source of nitrogen. At vents, dissolved organic nitrogen (for example, free amino acids) is quite low (Johnson et al., 1986), while inorganic nitrogen compounds are typically abundant. Some vent fluids contain nM to mM concentrations of dissolved ammonium, which is easily assimilated by many organisms. However, there are no data on ammonium concentrations at the ELSC (Tivey, 2007). Nitrate, however, is typically very abundant in seawater surrounding vents (occurring at B40 mM; Johnson et al., 1986). Nitrate can be used both as a primary nitrogen source for biosynthesis and growth and as a respiratory terminal electron acceptor. Assimilatory nitrate reduction canonically utilizes the cytoplasmic nitrate reductase Nas. Dissimilatory nitrate reduction (DNR) frequently utilizes the membranebound respiratory nitrate reductase Nar, but in some bacteria may also be catalyzed via a periplasmic– enzyme complex (Nap) (Potter et al., 2001). The nitrite generated by DNR may be further reduced to ammonia via dissimilatory nitrate reduction to ammonia (DNRA), which may then be utilized for biosynthesis (though Nap has not typically been associated with nitrate assimilation, Berks, 1995). In both assimilatory nitrate reduction and DNRA, the resulting ammonium is typically assimilated by the glutamine synthetase-glutamate synthase or glutamate dehydrogenase pathways (Reitzer, 2003). In all of the metatranscriptomes, we found the expression of some genes typically associated with both assimilatory and dissimilatory nitrate reduction, as well as for ammonium assimilation. Curiously, though, we did not find evidence for complete expression of any of the canonical pathways. Instead, periplasmic nitrate reductase (Nap) appeared to catalyze nitrate reduction as the first step for both assimilation and respiration. Genes involved in ammonium assimilation comprised a substantial portion of all metatranscriptomes,

indicating that all Alviniconcha symbionts were poised to assimilate ammonium either from the reduction of nitrate or from the environment (Figure 3, Supplementary Table S1). Both e- and gproteobacterial symbionts showed substantial expression of glutamine synthetase-glutamate synthase and ammonium transporters. As mentioned above, all symbionts were poised for nitrate reduction in the periplasm via the Nap complex. We did not detect the periplasmic nitrite reductase Nrf, which is typically the next step in Nap-catalyzed DNRA (Potter et al., 1999). However, both g- and e-dominated transcriptomes showed expression of the narK nitrite/nitrate transporter and cytoplasmic ammonifying nitrite reductases, representing a potential mechanism for assimilation of periplasmically-reduced nitrate via the shuttling of nitrite into the cytoplasm and subsequent reduction to ammonium and assimilation by glutamine synthetase-glutamate synthase (Figure 3, Supplementary Table S1). This model represents an alternative to the typical pathway for DNRA. The substantial expression of genes involved in respiratory denitrification suggests another possible fate for periplasmic nitrite (Figure 3, Supplementary Table S1), raising the possibility that Alviniconcha symbionts may be utilizing nitrate as an alternative electron acceptor to oxygen, potentially reducing competition for oxygen with the host (Hentschel and Felbeck, 1993; Hentschel et al., 1996). Though we did not detect transcripts for the canonical dissimilatory nitrate reductase Nar, in other bacteria, Nap has been shown to catalyze the first step in aerobic denitrification, as the presence of oxygen inhibits activity of Nar (Potter et al., 2001). We posit that Nap has a similar role in Alviniconcha symbionts. All of our samples contained transcripts for the rest of the denitrification pathway, including periplasmic respiratory cytochrome cd1 nitrite reductase NirS, the nitric oxide–reductase complex Nor, and the nitrous oxide–reductase complex Nos. Denitrification genes were more abundantly and consistently expressed in the e-dominated transcriptomes, where they constituted around 2% of all reads. These genes were less abundant (0.3% of reads) in the g-proteobacterial metatranscriptomes. Notably, NirS, which serves the reduction of nitrite to nitric oxide, and thus may serve to commit nitrite to a dissimilatory pathway, was B50-fold more abundant in the e-dominated samples (Figure 3). Functionally, this assemblage of assimilatory and dissimilatory genes may represent a strategy well suited for life around hydrothermal vents, where fluid mixing leads to ammonium concentrations that are inversely correlated with availability of oxygen as a terminal electron acceptor. The model outlined in Figure 3 would permit purely respiratory reduction of nitrate in holobionts exposed to oxygen-poor and ammonium-rich vent fluid. Conversely, holobionts in more aerobic conditions, with less access to ammonium, could decrease complete denitrification to dinitrogen in favor of assimilating
The ISME Journal

!

!

!

32

Metatranscriptomes of vent snail symbionts JG Sanders and RA Beinart et al 1564

nitrate to meet the needs of biosynthesis. Under this hypothesis, the expression differences we observed between g- and e-dominated metatranscriptomes would suggest that these symbionts were engaged primarily in either nitrogen assimilation or denitrification in response to variations in water chemistry in their respective habitats. Despite differences in expression, the complement of nitrogen genes was remarkably consistent between e- and g-dominated metatranscriptomes. The similarities in nitrogen gene content were especially striking in light of the large differences we observed in sulfur and carbon pathways. Where the latter differences were typical of pathways found in free-living members of their respective proteobacterial classes, the combination of nitrogenrelated genes we observed in both classes of Alviniconcha symbionts was fairly unusual, but could potentially catalyze functionally identical pathways in both classes of symbiont. At hydrothermal vents, the capacity to use nitrate for both biosynthesis and respiration is widespread among e-proteobacteria (Sievert and Vetriani, 2012), including the free-living relatives of Alviniconcha e-proteobacterial symbionts, Sulfurimonas (Takai et al., 2006; Sievert et al., 2008; Sikorski et al., 2010). Nitrate respiration is less common among free-living vent g-proteobacteria (Sievert and Vetriani, 2012), though, curiously, patterns of nitrogen gene expression similar to the Alviniconcha symbionts have been observed in other g-proteobacterial symbionts, such as those associated with vent tubeworms (Markert et al., 2011; Robidart et al., 2011). Although this model remains to be validated, such functional convergence may reflect similar selective pressures imposed by life in this environment, as well as the symbiotic lifestyle.
Flagellar genes

Flagellar genes showed striking differences in expression between e- and g-proteobacterial metatranscriptomes (Figure 4, Supplementary Table S1), hinting at potential differences in host–symbiont interactions. The e-dominated samples expressed transcripts for at least 30 flagellum-related genes, including flagellins flaAB and transcripts associated with the flagellar hook, ring, motor, basal body, and biosynthesis (Supplementary Table S1). Only 10 flagellum-related genes were recovered from g-dominated metatranscriptomes and, in aggregate, were B20-fold lower in abundance. While the diversity of roles that flagellar genes have in other symbiotic bacteria complicates interpretation (Anderson et al., 2010), we propose three hypotheses that might explain the observed differences in expression. First, if flagella are used primarily for motility, their abundant expression in mature-host associations may signal differences in symbiont motility and transmission dynamics between the e- and g-proteobacterial symbionts. Riftia tubeworm symbionts, while
The ISME Journal

possessing a large number of genes related to motility and chemotaxis, do not appear to possess flagella while inhabiting the host trophosome (Harmer et al., 2008; Robidart et al., 2008). Instead, they may utilize flagella during horizontal transmission (Harmer et al., 2008), when flagellar motility could be important in escaping from parental host tissue and/or chemotaxis towards a new host. Here, the abundant flagellar gene expression in e-symbionts could indicate that they are actively transmitted throughout the lifetime of the host. The lower expression observed in the g-hosting snails might in turn reflect either a different transmission strategy or, potentially, temporal differences in symbiont transmission. Second, flagellar proteins are commonly used in host recognition and attachment. It is plausible that the expression of flagellar genes in e-dominated metatranscriptomes relates to host recognition (that is, specificity). Flagellar proteins are critical to symbiont recognition and colonization in other systems: for example, the Euprymna-Vibrio symbioses (Nyholm et al., 2000; Millikan and Ruby, 2004), another highly specific, horizontally transmitted marine symbiosis. A previous study found that one Alviniconcha host type nearly always hosted solely e-proteobacterial symbionts, while others hosted mixed populations of the two g-proteobacterial symbiont lineages and, occasionally, the e-proteobacterial symbionts (Beinart et al., 2012). The expression of flagellin in e-proteobacterial symbionts may contribute to this specificity. Finally, flagellar genes may also mediate nutritional export from symbiont to host. Ring- and hookassociated flagellar proteins have been shown to have an important secretory role in the intracellular symbionts of aphids (Maezawa et al., 2006; Toft and Fares, 2008), though they have lost genes for the flagellin tail proteins, which were abundantly expressed in our e-dominated samples. In Alviniconcha, the mode of nutrient transfer in g-hosting individuals may predominantly be via digestion of symbiont cells, as is thought to be the case for g-proteobacterial symbionts of other vent animals (Lee et al., 1999). In contrast, translocation of small organic compounds from symbiont to host may have a bigger role in Alviniconcha hosting e-proteobacteria. Compound-specific isotopic observations made by Suzuki et al. (2005) suggest as much, demonstrating that symbiont-associated fatty acids are detected in non-symbiotic host tissues of g-, but not e-hosting Alviniconcha.
Transposons

Another surprising difference between symbiont types was the increased abundance of transposases in the g-dominated metatranscriptomes, where predicted transposases accounted for 3–7% of all bacterial transcripts via IMG in MG-RAST (SEED called around 2–5% of the transcripts transposons). Predicted transposases were present

!

!

!

33

Metatranscriptomes of vent snail symbionts JG Sanders and RA Beinart et al

in the e-dominated samples, but were much lower in abundance and matched largely to different transposase families (Figure 4, Supplementary Table S1). The presence of transposons in the genomes of other chemoautotrophic symbionts is variable: they are undetected in the genomes of the vertically-transmitted endosymbiont of vent clams (Kuwahara et al., 2007; Newton et al., 2007), while those of the horizontally transmitted vent tubeworm endosymbionts contain at least one (Robidart et al., 2008; Gardebrecht et al., 2012), and nearly 20% of an endosymbiont genome from the oligochaete Olavius algarvensis is composed of transposable elements (Woyke et al., 2006). Moran and Plague (2004) have proposed that the proliferation of mobile genetic elements occurs early during the transition to an obligate intracellular lifestyle, as genetic bottlenecks during transmission decrease the effective population size of the symbionts, leading to decreased strength of selection. Combined with the lack of a free-living life stage, this is thought to relax purifying selection on the symbiont genome. Although conflicting with the current hypothesis that both g-proteobacterial and e-proteobacterial symbionts are transmitted via the environment, the dramatic differences in transposase expression observed among these metatranscriptomes hints at the possibility that these two distinct symbiont–host associations either represent different stages of evolutionary development, or exhibit differing transmission modes. When taken in conjunction with the corresponding differences in flagellar gene expression, these data raise the hypothesis that e-proteobacterial symbionts in Alviniconcha, relative to the g-proteobacterial symbionts, experience more frequent dispersal and fewer genetic bottlenecks.

1565

Unexpectedly, the observed differences in flagellar genes and transposons between e- and g-dominated metatranscriptomes hint at differences in symbiont life histories, potentially related to the dynamics of association between host and symbiont, including mode of transmission and nutrient exchange. Though other chemoautotrophic symbioses have been described with widely varying specificities and transmission mechanisms (reviewed in Dubilier et al., 2008), Alviniconcha is thus far unique in that close relatives within the genus host unrelated symbionts, each with apparently variable degrees of specificity (Beinart et al., 2012). The data presented here illustrate the value of using in situ preservation and shore-based transcriptomics to examine symbiont physiological poise. This technology and methodology allowed us to test a priori hypotheses as well as to identify previously unrecognized differences among these symbionts. Future studies should employ such approaches when studying both host and symbiont gene expression within and among different geochemical habitats to better understand the complex relationships among symbionts, their hosts, and the environment.

Acknowledgements
This material is based upon work supported by the National Science Foundation (OCE-0732369 to PRG and GRF grant no. DGE-1144152 to JGS and RAB), as well as Moore Foundation Investigator and Agouron Institute grants to EFD. We thank the crews of the RV Thomas G Thompson and the ROV JASON II, C DiPerna and P Meneses for assisting with the design and building of the ISMASH and J Dang for assistance with sample processing. We also thank J Bryant, R Barry and T Palden for their help in complementary DNA preparation and pyrosequencing and J Delaney, C Cavanaugh, A Knoll and C Marx for their helpful comments and editing that improved this article.

Conclusions
Our results reveal that Alviniconcha symbionts exhibited marked differences in gene expression related to energy metabolism. The predominance of both hydrogen oxidation and DNR genes in the e-dominated metatranscriptomes would suggest that these holobionts live in more highly reduced and potentially less oxygen-rich fluids. This is consistent with the previously observed patterns of distribution across a regional gradient, wherein e-hosting Alviniconcha were most abundant in the more sulfidic, hydrogen-rich fluids found at the northern vent fields (Beinart et al., 2012). Though these differences in expression do not necessarily imply differences in metabolic capability (this is better addressed via genomic sequencing of each symbiont type), their striking correlation with holobiont biogeography supports the hypothesis that symbiont physiology has an important role in habitat partitioning among the host types in this genus.

References
Anderson JK, Smith TG, Hoover TR. (2010). Sense and sensibility: flagellum-mediated gene regulation. Trends Microbiol 18: 30–37. Beinart RA, Sanders JG, Faure B, Sylva SP, Lee RW, Becker EL et al. (2012). Evidence for the role of endosymbionts in regional-scale habitat partitioning by hydrothermal vent symbioses. Proc Natl Acad Sci USA 109: E3241–E3250. Berg I. (2011). Ecological aspects of the distribution of different autotrophic CO2 fixation pathways. Appl Environ Microbiol 77: 1925–1936. Berks B. (1995). Enzymes and associated electron transport systems that catalyse the respiratory reduction of nitrogen oxides and oxyanions. Biochim Biophys Acta 1232: 97–173. Caporaso JG, Kuczynski J, Stombaugh J, Bittinger K, Bushman FD, Costello EK et al. (2010). QIIME allows
The ISME Journal

!

!

!

34

Metatranscriptomes of vent snail symbionts JG Sanders and RA Beinart et al 1566

analysis of high-throughput community sequencing data. Nat Meth 7: 335–336. Childress JJ, Fisher CR, Brooks JM, Kennicutt MC, Bidigare R, Anderson AE. (1986). A methanotrophic marine molluscan (bivalvia, mytilidae) symbiosis: mussels fueled by gas. Science 233: 1306–1308. Childress JJ, Fisher CR, Favuzzi JA, Sanders NK. (1991). Sulfide and carbon dioxide uptake by the hydrothermal vent clam, Calyptogena magnifica, and its chemoautotrophic symbionts. Physiol Zool 64: 1444–1470. Childress JJ, Girguis PR. (2011). The metabolic demands of endosymbiotic chemoautotrophic metabolism on host physiological capacities. J Exp Biol 214: 312–325. Dowd S, Callaway T, Wolcott R, Sun Y, McKeehan T, Hagevoort R et al. (2008). Evaluation of the bacterial diversity in the feces of cattle using 16S rDNA bacterial tag-encoded FLX amplicon pyrosequencing (bTEFAP). BMC Microbiol 8: 125. Dubilier N, Bergin C, Lott C. (2008). Symbiotic diversity in marine animals: the art of harnessing chemosynthesis. Nat Rev Micro 6: 725–740. Edgar RC. (2010). Search and clustering orders of magnitude faster than BLAST. Bioinformatics 26: 2460–2461. Edgar RC, Haas BJ, Clemente JC, Quince C, Knight R. (2011). UCHIME improves sensitivity and speed of chimera detection. Bioinformatics 27: 2194–2200. Felbeck H. (1981). Chemoautotrophic potential of the hydrothermal vent tube worm, Riftia pachyptila jones (Vestimentifera). Science 213: 336–338. Fisher CR, Childress JJ. (1984). Substrate Oxidation by Trophosome Tissue from Riftia pachyptila Jones (Phylum pogonophora vol. 5. Elsevier: Amsterdam, PAYS-BAS. Frigaard N-U, Dahl C. (2009). Sulfur Metabolism in phototrophic sulfur bacteria. Adv Microb Physiol 54: 103–200. Gardebrecht A, Markert S, Sievert SM, Felbeck H, Thurmer A, Albrecht D et al. (2012). Physiological homogeneity among the endosymbionts of Riftia pachyptila and Tevnia jerichonana revealed by proteogenomics. ISME J 6: 766–776. Ghosh W, Dam B. (2009). Biochemistry and molecular biology of lithotrophic sulfur oxidation by taxonomically and ecologically diverse bacteria and archaea. FEMS Microbiol Rev 33: 999–1043. Girguis PR, Childress JJ. (2006). Metabolite uptake, stoichiometry and chemoautotrophic function of the hydrothermal vent tubeworm Riftia pachyptila: responses to environmental variations in substrate concentrations and temperature. J Exp Biol 209: 3516–3528. Gomez-Alvarez V, Teal TK, Schmidt TM. (2009). Systematic artifacts in metagenomes from complex microbial communities. ISME J 3: 1314–1317. Gracey AY. (2007). Interpreting physiological responses to environmental change through gene expression profiling. J Exp Biol 210: 1584–1592. Gracey AY, Chaney ML, Boomhower JP, Tyburczy WR, Connor K, Somero GN. (2008). Rhythms of gene expression in a fluctuating intertidal environment. Curr Biol 18: 1501–1507. Grimm F, Franz B, Dahl C. (2008). Thiosulfate and Sulfur Oxidation in Purple Sulfur Bacteria Microbial Sulfur Metabolism In: Dahl C, Friedrich CG (eds).Springer: Berlin Heidelberg, pp 101–116.
The ISME Journal

Harada M, Yoshida T, Kuwahara H, Shimamura S, Takaki Y, Kato C et al. (2009). Expression of genes for sulfur oxidation in the intracellular chemoautotrophic symbiont of the deep-sea bivalve Calyptogena okutanii. Extremophiles 13: 895–903. Harmer TL, Rotjan RD, Nussbaumer AD, Bright M, Ng AW, DeChaine EG et al. (2008). Free-living tube worm endosymbionts found at deep-sea vents. Appl Environ Microbiol 74: 3895–3898. Hentschel U, Felbeck H. (1993). Nitrate respiration in the hydrothermal vent tubeworm Riftia pachyptila. Nature 366: 338–340. Hentschel U, Hand S, Felbeck H. (1996). The contribution of nitrate respiration to the energy budget of the symbiont-containing clam Lucinoma aequizonata: a calorimetric study. J Exp Biol 199: 427–433. Hugler M, Wirsen CO, Fuchs G, Taylor CD, Sievert SM. (2005). Evideince for autotrophic CO2 fixation via the reductive tricarboxylic acid cycle by members of the epsilon subdivision of Proteobacteria. J Bacteriol 187: 3020–3027. Huson DH, Mitra S, Ruscheweyh H-J, Weber N, Schuster SC. (2011). Integrative analysis of environmental sequences using MEGAN4. Genome Res 21: 1552–1560. Hugler M, Petersen JM, Dubilier N, Imhoff JF, Sievert SM. ¨ (2011). Pathways of carbon and energy metabolism of the epibiotic community associated with the deep-sea hydrothermal vent shrimp Rimicaris exoculata. PLoS One 6: e16018. Johnson KS, Beehler CL, Sakamoto-Arnold CM, Childress JJ. (1986). In situ measurements of chemical distributions in a deep-sea hydrothermal vent field. Science 231: 1139–1141. Kuwahara H, Yoshida T, Takaki Y, Shimamura S, Nishi S, Harada M et al. (2007). Reduced genome of the thioautotrophic intracellular symbiont in a deep-sea clam, Calyptogena okutanii. Curr Biol 17: 881–886. Lee RW, Robinson JJ, Cavanaugh CM. (1999). Pathways of inorganic nitrogen assimilation in chemoautotrophic bacteria-marine invertebrate symbioses: expression of host and symbiont glutamine synthetase. J Exp Biol 202: 289–300. Maezawa K, Shigenobu S, Taniguchi H, Kubo T, Aizawa S-i, Morioka M. (2006). Hundreds of flagellar basal bodies cover the cell surface of the endosymbiotic bacterium Buchnera aphidicola sp. strain APS. J Bacteriol 188: 6539–6543. Markert S, Gardebrecht A, Felbeck H, Sievert SM, Klose J, Becher D et al. (2011). Status quo in physiological proteomics of the uncultured Riftia pachyptila endosymbiont. Proteomics 11: 3106–3117. Meyer F, Paarmann D, D’Souza M, Olson R, Glass E, Kubal M et al. (2008). The metagenomics RAST server—a public resource for the automatic phylogenetic and functional analysis of metagenomes. BMC Bioinformatics 9: 386. Millikan DS, Ruby EG. (2004). Vibrio fischeri flagellin A is essential for normal motility and for symbiotic competence during initial squid light organ colonization. J Bacteriol 186: 4315–4325. Moran NA, Plague GR. (2004). Genomic changes following host restriction in bacteria. Curr Opin Genet Dev 14: 627–633. Mottl MJ, Seewald JS, Wheat CG, Tivey MK, Michael PJ, Proskurowski G et al. (2011). Chemistry of hot springs along the Eastern Lau Spreading Center. Geochimica Et Cosmochimica Acta 75: 1013–1038.

!

!

!

35

Metatranscriptomes of vent snail symbionts JG Sanders and RA Beinart et al 1567

Nakagawa S, Takai K. (2008). Deep-sea vent chemoautotrophs: diversity, biochemistry and ecological significance. FEMS Microbiol Ecol 65: 1–14. Nakagawa S, Takai K, Inagaki F, Hirayama H, Nunoura T, Horikoshi K et al. (2005). Distribution, phylogenetic diversity and physiological characteristics of epsilonProteobacteria in a deep-sea hydrothermal field. Environ Microbiol 7: 1619–1632. Newton ILG, Woyke T, Auchtung TA, Dilly GF, Dutton RJ, Fisher MC et al. (2007). The Calyptogena magnifica chemoautotrophic symbiont genome. Science 315: 998–1000. Nyholm SV, Stabb EV, Ruby EG, McFall-Ngai MJ. (2000). Establishment of an animal-bacterial association: Recruiting symbiotic vibrios from the environment. Proc Natl Acad Sci 97: 10231–10235. Petersen JM, Zielinski FU, Pape T, Seifert R, Moraru C, Amann R et al. (2011). Hydrogen is an energy source for hydrothermal vent symbioses. Nature 476: 176–180. Potter L, Angove H, Richardson D, Cole J. (2001). Nitrate reduction in the periplasm of gram-negative bacteria. Adv Microb Physiol 45: 51–112. Potter LC, Millington P, Griffiths L, Thomas GH, Cole JA. (1999). Competition between Escherichia coli strains expressing either a periplasmic or a membranebound nitrate reductase: does Nap confer a selective advantage during nitrate-limited growth? Biochem J 344: 77–84. Pruesse E, Quast C, Knittel K, Fuchs BM, Ludwig W, Peplies Jr et al. (2007). SILVA: a comprehensive online resource for quality checked and aligned ribosomal RNA sequence data compatible with ARB. Nucleic Acids Res 35: 7188–7196. Reeder J, Knight R. (2010). Rapidly denoising pyrosequencing amplicon reads by exploiting rank-abundance distributions. Nat Meth 7: 668–669. Reitzer L. (2003). Nitrogen assimilation and global regulation in Escherichia coli. Annu Rev Microbiol 57: 155–176. Robidart JC, Bench SR, Feldman RA, Novoradovsky A, Podell SB, Gaasterland T et al. (2008). Metabolic versatility of the Riftia pachyptila endosymbiont revealed through metagenomics. Environ Microbiol 10: 727–737. Robidart JC, Roque A, Song P, Girguis PR. (2011). Linking hydrothermal geochemistry to organismal physiology: physiological versatility in Riftia pachyptila from sedimented and basalt-hosted vents. PLoS One 6: e21692. Sievert SM, Scott KM, Klotz MG, Chain PSG, Hauser LJ, Hemp J et al. (2008). Genome of the epsilonproteobacterial chemolithoautotroph Sulfurimonas denitrificans. Appl Environ Microbiol 74: 1145–1156. Sievert SM, Vetriani C. (2012). Chemoautotrophy at deepsea vents: past, present, and future. Oceanography 25: 218–233. Sikorski J, Munk C, Lapidus C, Djao ODN, Lucas S, Glavina Del Rio T et al. (2010). Complete genome sequence of Sulfurimonas autotrophica type strain (OK10). Stand Genomic Sci 3: 194–202. Stewart F, Dmytrenko O, DeLong E, Cavanaugh C. (2011). Metatranscriptomic analysis of sulfur oxidation genes in the endosymbiont of Solemya velum. Front Microbiol 2: 134.

Stewart FJ, Newton ILG, Cavanaugh CM. (2005). Chemosynthetic endosymbioses: adaptations to oxic-anoxic interfaces. Trends Microbiol 13: 439–448. Stewart FJ, Ottesen EA, DeLong EF. (2010). Development and quantitative analyses of a universal rRNA-subtraction protocol for microbial metatranscriptomics. ISME J 4: 896–907. Suzuki Y, Kojima S, Sasaki T, Suzuki M, Utsumi T, Watanabe H et al. (2006). Host-symbiont relationships in hydrothermal vent gastropods of the genus Alviniconcha from the Southwest Pacific. Appl Environ Microbiol 72: 1388–1393. Suzuki Y, Sasaki T, Suzuki M, Nogi Y, Miwa T, Takai K et al. (2005). Novel chemoautotrophic endosymbiosis between a member of the Epsilonproteobacteria and the hydrothermal-vent gastropod Alviniconcha aff. hessleri (Gastropoda: Provannidae) from the Indian Ocean. Appl Environ Microbiol 71: 5440–5450. Takai K, Campbell BJ, Cary SC, Suzuki M, Oida H, Nunoura T et al. (2005). Enzymatic and genetic characterization of carbon and energy metabolisms by deep-sea hydrothermal chemolithoautotrophic isolates of epsilonproteobacteria. Appl Environ Microbiol 71: 7310–7320. Takai K, Suzuki M, Nakagawa S, Miyazaki M, Suzuki Y, Inagaki F et al. (2006). Sulfurimonas paralvinellae sp. nov., a novel mesophilic, hydrogen- and sulfuroxidizing chemolithoautotroph within the Epsilonproteobacteria isolated from a deep-sea hydrothermal vent polychaete nest, reclassification of Thiomicrospira denitrificans as Sulfurimonas denitrificans comb. nov. and emended description of the genus Sulfurimonas. Int J Syst Evol Micr 56: 1725–1733. Tivey MK. (2007). Generation of seafloor hydrothermal vent fluids and associated mineral deposits. Oceanography 20: 50–65. Toft C, Fares MA. (2008). The evolution of the flagellar assembly pathway in endosymbiotic bacterial genomes. Mol Biol Evol 25: 2069–2076. Vignais PM, Billoud B. (2007). Occurrence, classification, and biological function of hydrogenases: an overview. Chem Rev 107: 4206–4272. Wendeberg A, Zielinski FU, Borowski C, Dubilier N. (2012). Expression patterns of mRNAs for methanotrophy and thiotrophy in symbionts of the hydrothermal vent mussel Bathymodiolus puteoserpentis. ISME J 6: 104–112. Wittenberg JB, Stein JL. (1995). Hemoglobin in the symbiont-harboring gill of the marine gastropod Alviniconcha hessleri. Biol Bull 188: 5–7. Woyke T, Teeling H, Ivanova NN, Huntemann M, Richter M, Gloeckner FO et al. (2006). Symbiosis insights through metagenomic analysis of a microbial consortium. Nature 443: 950–955. Yamamoto M, Takai K. (2011). Sulfur metabolisms in epsilon- and gamma-Proteobacteria in deep-sea hydrothermal fields. Front Microbiol 2192.

This work is licensed under a Creative Commons Attribution-NonCommercialNoDerivs 3.0 Unported License. To view a copy of this license, visit http://creativecommons.org/ licenses/by-nc-nd/3.0/

Supplementary Information accompanies this paper on The ISME Journal website (http://www.nature.com/ismej)
The ISME Journal

!

!

!

36

Chapter 4 The uptake and excretion of partially oxidized sulfur broadens our understanding of the energy resources metabolized by hydrothermal vent symbioses

(formatted for journal submission)

Abstract Symbioses between animals and chemoautotrophic bacteria predominate at hydrothermal vents. In these associations, symbiotic bacteria utilize chemical reductants for the energy to support autotrophy, providing primary nutrition for the host. It is well known that reductants in venting fluid (e.g., sulfide, methane, hydrogen) can fuel productivity by vent symbioses. At vents along the Eastern Lau Spreading Center (ELSC), partially oxidized sulfur (e.g., thiosulfate, polysulfides) has also been detected around communities of symbiotic molluscs. Thiosulfate is known to drive autotrophy in free-living sulfur oxidizing microbes as well as the epibiotic symbionts of some vent crustaceans, but has never been shown in a an intact association between animals and intracellular symbionts. To test this metabolism in vent endosymbioses, we used high-pressure, flow-through incubations to maintain three symbiotic molluscs from the ELSC - the snails Alviniconcha and Ifremeria nautilei, and the mussel Bathymodiolus brevior – at conditions mimicking those in situ. We assessed their productivity when oxidizing sulfide or thiosulfate via the incorporation of isotopically labeled inorganic carbon, while concurrently measuring their effect on sulfur flux from the aquaria with voltammetric microelectrodes. We found that the symbionts of all three genera supported carbon fixation while oxidizing thiosulfate as well as sulfide, though at different rates. Additionally, we showed that these symbioses excreted partially oxidized sulfur under highly sulfidic conditions, which illustrates that these symbioses could represent a source for partially oxidized sulfur in their habitat. Finally, by examining the rate at which individuals incorporated the isotopic label, we revealed spatial disparity in the rates of carbon fixation among the animals in our incubations that might have implications for the variability of productivity in situ. Altogether, this work demonstrates that thiosulfate may be an ecologically important energy source for vent symbioses and that, beyond the removal of vent-

!

38

derived sulfide, these symbioses may also impact the local geochemical regime through the excretion of sulfur compounds.

Introduction Hydrothermal vents support dense assemblages of invertebrates, many of which rely on chemoautotrophic bacterial symbionts for nourishment. These microbial-animal associations aggregate around vent orifices so that their symbionts can utilize chemicals in venting fluid for the energy to support carbon fixation (Stewart et al. 2005). To date, the symbionts of animals from multiple phyla have been shown to use sulfide, methane and/or hydrogen from vent fluid as energy sources (Belkin et al. 1986; Nelson & Hagen 1995; Girguis & Childress 2006; Childress et al. 1991; Ponsard et al. 2012; Watsuji et al. 2012; Watsuji et al. 2010; Fisher et al. 1987; Robinson et al. 1998; Petersen et al. 2011). Though these are likely to be the most important forms of energy for vent symbioses (Amend et al. 2011), other reduced compounds can be present in and around venting fluid (Gartman et al. 2011; Luther et al. 2001; Luther Iii et al. 2001; Schmidt et al. 2008). In particular, the partially oxidized sulfur compounds polysulfide and thiosulfate, which are produced from the abiotic and/or biological oxidation of vent-derived sulfide (Mullaugh et al. 2008; Gartman et al. 2011), have been detected at some vent systems (Gartman et al. 2011; Mullaugh et al. 2008; Waite et al. 2008; Gru et al. 1998). These compounds are typically present away from vent outlets (Gartman et al. 2011; Mullaugh et al. 2008; Waite et al. 2008). Since competition among vent symbioses for vent-derived resources is likely to be intense, the use of reductants that are not sourced directly from vent fluid would be energetically advantageous. Moreover, since the proximity that is required for access to reductants in venting fluid requires exposure to high temperatures and toxic chemicals (e.g., sulfide), the exploitation of reductants that are not obtained directly from the vent could be !
39

beneficial to symbioses that cannot tolerate such conditions. Thus, the use of partially oxidized sulfur has many ecological advantages for vent symbioses. It is well known that partially oxidized sulfur compounds can be used as energy for carbon fixation by some free-living vent chemoautotrophs (Teske et al. 2000; Sievert & Vetriani 2012), as well as by chemoautotroph-animal symbioses from non-vent ecosystems (Dando et al. 1986; Scott & Cavanaugh 2007; Giere et al. 1988; Childress et al. 1998). Moreover, experimental studies have observed thiosulfate-driven carbon fixation among the epibiotic symbionts of vent crustaceans (Watsuji et al. 2012; Watsuji et al. 2010; Ponsard et al. 2012; Polz et al. 1998). A few studies have also measured thiosulfate oxidation in vitro by the intracellular symbionts of vent mussels and clams that were physically separated from their hosts (Belkin et al. 1986; Wilmot & Vetter 1990; Fisher et al. 1987; Childress et al. 1991; Nelson et al. 1995). To date, thiosulfatedriven carbon fixation has not been demonstrated in an intact symbiosis between a vent animal and intracellular symbionts; thus, the extent to which this metabolism is important for productivity many vent symbioses remains unclear. The abundance of partially oxidized sulfur in the vent environment has been best characterized at vents along the Eastern Lau Spreading Center (ELSC), in the southwestern Pacific near the island of Tonga. Three molluscs dominate at these vent fields: the provannid snails Alviniconcha and Ifremeria nautilei, as well as the mussel Bathymodiolus brevior. Though each of these symbioses can support net carbon fixation with sulfide oxidation (Henry et al. 2008), they associate with different, phylogenetically distant lineages of symbiotic bacteria that are housed in in their gill tissue (Y. Suzuki, Kojima, Watanabe, et al. 2006b; Y. Suzuki, Kojima, Sasaki, et al. 2006a; Y. Suzuki, Sasaki, M. Suzuki, Tsuchida, et al. 2005b; Y. Suzuki, Sasaki, M. Suzuki, Nogi, et al. 2005a; Beinart et al. 2012; Dubilier et al. 1998; Stein et al. 1988). Interestingly, these animals typically form concentric patterns around vent orifices, with Alviniconcha found closest to !
40

the outlet, followed by a zone of I. nautilei, and finally B. brevior at the very edges of the assemblages (Podowski et al. 2009; Podowski et al. 2010; Waite et al. 2008). It has been suggested that these zones reflect both preference for particular temperature and chemical regimes by the symbioses, and competitive interactions among them (Podowski et al. 2010; Sen et al. 2013). In addition to sulfide originating from the venting fluid, partially oxidized sulfur compounds are common in and around these aggregations; surveys with in situ voltammetric microelectrodes have detected thiosulfate and polysulfides at concentrations up to 1000 and 400 μM, respectively (Waite et al. 2008; Mullaugh et al. 2008; Gartman et al. 2011). Interestingly, the presence and abundance of these sulfur compounds correspond to the distribution of the mollusc genera, which might be indicative of specific exchanges between particular symbioses and the pools of partially oxidized sulfur compounds. In particular, the highest concentrations of thiosulfate in the aggregations are found over the zones of B. brevior (Waite et al. 2008; Mullaugh et al. 2008), while the highest concentrations of polysulfides are found among the I. nautilei (Gartman et al. 2011; Waite et al. 2008). To determine whether these symbioses can use partially reduced sulfur compounds to support carbon fixation, we conducted a series of shipboard incubations with all three ELSC mollusc symbioses using high-pressure, flow-through aquaria. Inline voltammetric electrodes allowed us to assess total sulfur flux through the aquaria, while an isotopic tracer allowed us to quantify individual productivity during the incubations. The data presented here reveal which of these symbioses can support carbon fixation with thiosulfate, and demonstrate excretion of partially oxidized sulfur under highly sulfidic conditions. Additionally, the data suggest that there is variability in individual carbon fixation rates within an assemblage of these symbioses that may be related to competition for resources.

!

41

Methods Animal collections Animals were collected from the vent fields ABE (-20°45.8’ by -176°11.5’) or Tu’i Malila (-21°59.4' by -176°34.1') at the Eastern Lau Spreading Center (ELSC) by the remotely operated vehicle JASON II during expedition TM-235 in 2009 on board the R/V Thomas G. Thompson. Animals were brought to the ship in insulated containers and, once on board, were kept in 4°C seawater. Alviniconcha or I. nautilei that were responsive to touch and B. brevior that were tightly closed upon recovery were immediately placed in the flow-through, titanium aquaria that represent part of the high-pressure respirometry system (HPRS; described below). For each incubation, between 3 and 10 individuals of each genus were placed into three separate aquaria. Animals were situated upon perforated acrylic partitions so that they were stacked vertically in the cylindrical aquaria.

Incubation conditions and acclimation Three incubations (hereafter ‘rate experiments’ or ‘experiments’) were performed to compare net sulfur uptake and excretion rates, as well as carbon fixation rates, by the three mollusc genera at three different conditions: 105 μM sulfide, 300 μM thiosulfate, and no sulfur compounds. During each rate experiment, an empty high-pressure aquarium (control) was run alongside the three animal-containing aquaria in order to account for systematic losses and enable the most robust mass specific rate determinations. In addition, two additional incubations (hereafter ‘exposure treatments’ or ‘treatments’) were performed to establish the extent of variation in carbon fixation rates among the animals within each vessel. Exposure treatments were run with a larger number of individuals per aquaria (sometimes double the number in the !
42

rate experiments) at 350 μM sulfide or 300 μM thiosulfate (exposure treatments lack a control aquaria). Prior to the start of each experiment or treatment, all animals were incubated in aerated seawater at 15°C and 25 MPa for 8 hours prior to the addition of sulfur compounds and isotopic tracer. During the no sulfur experiment, animals were acclimated with ~300 μM sulfide before sulfur was stopped and isotopic tracer was added.

Incubations with the high-pressure respirometry system (HPRS) To measure sulfur oxidation and carbon fixation rates under in situ-like conditions, rate experiments and exposure treatments were performed with the HPRS (Fig.4.1). The HPRS was housed in a temperature-controlled intermodal shipping container maintained at 15-17°C. Surface seawater from the ship’s metal-free seawater systems was filtered to 0.2 μm via inline cartridge filters (Millipore Inc), then pumped into into a 40 L polypropylene carboy (Nalgene™). Filtered seawater was then amended with 1 g isotopically labeled sodium bicarbonate (as solution of 240 mM Na13CO3; 99.9% atom percent; Icon Services), to achieve a final 13C/12C atom percent of ~5% in the carboy. In addition, sodium nitrate (NaNO3) was added to achieve a final concentration of 40 µM, comparable to deep ocean water. For the thiosulfate experiment and treatment, 300 mM sodium thiosulfate (NaS2O3) was added to the amended seawater in carboy to achieve a final concentration of 300 μM. This was pumped into an acrylic gas equilibration column (Girguis et al. 2000), where it was bubbled with carbon dioxide, oxygen, nitrogen using mass flow controllers (Sierra Instruments Inc) to achieve concentrations of 4 mM, >300 µM, and 400 µM respectively (Table S4.1). The pH of the resulting input water was always 6-7. For the hydrogen sulfide experiment and treatment, the conditions were identical except for the absence of the thiosulfate, and the addition of gaseous

!

43

44

!

Figure 4.1 Schematic of the high-pressure respirometry system (HPRS). Filtered seawater is amended with chemicals to mimic in situ conditions, and then pumped through three titanium aquaria containing the symbiotic molluscs, and in some cases, through an additional, empty control aquaria. These aquaria are held at ~25 mPa with back-pressure valves. The input water and/or the aquaria effluent are directed, via a stream-selection valve, to an in-line voltammetric microelectrode system that measures the concentrations of sulfur compounds (modified from Nyholm et al., 2008).

!

5% H2S/95% N2 gas via a mass flow controller to achieve the target final concentrations (presented above). In all incubations, the resulting seawater from the equilibration column was then supplied to four high-pressure metering pumps (Lewa GmbH) equipped with titanium wetted parts. The pumps generated ~25 mPa and delivered fluid into the three or four titanium high-pressure aquaria at a rate of 10-16 ml min-1. Pressure was maintained via 316 stainless steel backpressure valves (StraVal Inc). The aquaria effluents and/or equilibration column seawater (hereafter ‘input water’) were directed toward an electronic, multi-position stream-selection valve (Valco Instruments Co. Inc.) that systematically sent each stream to analysis by a voltammetric microelectrode (see below), to collection for analyses on shore, or to waste.

Sulfur oxidation and excretion rates To determine the net sulfur oxidation rates, as well as detect the excretion of partially oxidized sulfur compounds, the concentrations of sulfur compounds in the effluent of the experimental aquaria were compared to the concentrations in effluent from the empty control aquarium (rate experiments) or to the concentrations in input water (exposure treatments). Oxidation (or uptake) and excretion (or production) of sulfur compounds is defined here, respectively, as an observed net decrease or increase in the concentrations of sulfur compounds in the effluent of the aquaria relative to the control effluent or the input water. The concentrations of the sulfur compounds sulfide (∑H2S and HS-), thiosulfate and polysulfides were measured via voltammetric microelectrodes (Luther et al. 2001; Brendel & Luther 1995). Though we were unable to quantify oxygen concentrations during the incubations, the voltammetric microelectrodes (see below) were always able to detect oxygen in the aquaria effluent during all incubations (minimum detection limit is 5 µM; (Gartman et al. 2011)), suggesting that oxygen !
45

was never completely depleted by the symbioses in the aquaria. The input and/or effluent water was measured in a cyclical series of 30 minute intervals throughout the duration of the experiment; one complete 2-hour series of 4 intervals starting with an experimental effluent and ending with either the control effluent or input water is hereafter referred to as a ‘set’. Electrochemical scans were performed at a rate of 1 per ~43 s, resulting in 42 measurements per 30 min interval. The detection limits for the voltammetric microelectrodes were 30 μM thiosulfate and 0.2 μM sulfide and polysulfide. The electrodes were calibrated for measurement of sulfide concentrations with measurements made via discrete water samples from either the input water (exposure treatment) or the control vessel effluent (rate experiment) as described below (Fig.S4.1). The electrodes were calibrated for measurement of thiosulfate concentration based on the 300 μM concentration in the input water. At 4 h intervals throughout the course of the experiments, 10 ml of input or control effluent water was also preserved with 1 M zinc acetate and stored at -20°C until analysis. Later, sulfide concentrations were determined via a colorimetric assay ((Cline 1969); Lamotte Co.) by comparing our unknowns to a standard curve varying from 1 to 500 µM on a Spectramax Plus 384 absorbance microplate reader (Molecular Devices, LLC). Net sulfur oxidation rates were calculated using data obtained after at least 10 h into the experiment, as this allowed for three turnovers in the volume of water in the aquaria. To calculate the concentrations of each sulfur compound during each 30 min interval, the first 10 scans of each interval were removed (i.e., the first 24% of the total scans in each interval) to exclude the transitory scans that occurred after the switch to a different aquarium effluent. The concentrations resulting from the remaining scans were averaged, resulting in a single concentration value per interval (hereafter, ‘interval concentration’). To calculate oxidation rates for each mollusc genus within a set, the interval concentration of the control effluent was !
46

subtracted from the interval concentration of the experimental effluent, and these in turn were divided by the total gill mass of the animals in each aquarium.

DIC isotopic composition To measure the exact amount of isotopic tracer Na13CO3 available during each experiment or treatment, input water was sampled 2-3 times over the course of each. Approximately 10 ml of input water taken directly from the gas equilibration column was filtered (0.2 μm) to remove particulate carbon. Dissolved inorganic carbon (DIC) in the samples was base-trapped with a solution of sodium hydroxide so that the final pH was >11 and stored frozen at -20°C in gas-tight, glass Hungate tubes until analysis. The atom percent of the DIC was measured at the Yale Institute of Biospheric Studies’ Earth System Center for Stable Isotopic Studies, where 1 ml of thawed sample was injected into pre-flushed 12 ml exetainers containing H3PO4 to evolve DIC as CO2 for analysis via a ThermoFinnigan DeltaPLUS Advantage mass spectrometer (Thermo Scientific) coupled to a Costech ECS 4010 EA elemental analyzer (Costech Analytical Technologies).

Sampling of experimental animals At the conclusion of each experiment, the aquaria were depressurized and animals were quickly removed from the high-pressure aquaria, excised from their shells, and total wet weight for each individual was determined via a motion-compensated shipboard balance (Childress & Mickel 1980). From these weights, each individual’s gill weight was estimated from linear equations derived from the regression of total body mass to gill mass (Fig.S2) for each genus. Gill and foot tissue was subsampled for isotopic analysis and frozen at -80°C until further processing. In addition, subsamples of gill tissue were homogenized and preserved in Trizol™ (Life !
47

Technologies) for extraction of nucleic acids. DNA was extracted from the Trizol™-preserved tissue samples following RNA extraction via the manufacturer’s protocol. DNA was backextracted from the resulting interphase with a buffer consisting of 4 M guanidine thiocyanate, 50 mM sodium citrate and 1 M Tris (free base). The DNA was then extracted again with chloroform:isoamyl alcohol and precipitated with isopropanol. The resulting DNA pellets were washed twice with 75% ethanol and air-dried. DNA pellets were resuspended in 8 mM sodium hydroxide, adjusted to pH 7-8 with 0.1 M HEPES and amended with 1 mM EDTA.

Symbiont identities Symbiont 16S rRNA genes were directly amplified from diluted I. nautilei and B. brevior DNA extracts using the universal bacterial primers 27F and 1492R (Lane 1991). PCR reactions were performed with Crimson Taq DNA polymerase (New England Biolabs, Inc.) for 2 min at 95 °C, 30 cycles of 30 s at 95°C, 30 s at 55°C, 90 s at 68°C, followed by 5 min at 72°C. PCR products were subjected to electrophoresis on a 1.2% (wt/vol) agarose gel stained with SYBR Safe (Invitrogen, Inc.) to check the quantity and the quality of the products using a U:Genius UV transilluminator (Syngene, Inc.). PCR products were cleaned with ExoSAP-IT (Affymetrix, Inc.), then bidirectionally sequenced. Quality assessment of the sequences and assembly of forward and reverse reads were performed in Geneious v6.1.6 (BioMatters, Inc.). Sequences were aligned with other symbiont and free-living Proteobacterial sequences using the SILVA Incremental Aligner v1.2.11 (Pruesse et al. 2012). A Bayesian inference phylogeny was produced with MrBayes (Huelsenbeck & Ronquist 2001) implementing the GTR+I+G model of substitution. Three replicate runs of 5 x 107 generations were performed with sampling every 103 generations and burn-in of 12,500 samples. Quantitative and qualitative diagnostics were performed for each of

!

48

the three runs using the Coda package in R (Plummer et al. 2006), the three replicate runs were combined, and a 50% majority rule consensus tree was created in MrBayes. Because Alviniconcha from the ELSC are known to host an assemblage of phylogenetically distinct symbionts (Beinart et al. 2012), direct amplification and sequencing of symbiont 16S rRNA genes was not performed. Instead, the symbiont populations associated with the experimental Alviniconcha were assessed as in Beinart et al. (2012), with three 16S rRNA gene quantitative PCR assays that are specific to their symbiont phylotypes. Briefly, we estimated the proportion of each symbiont phylotype in the diluted Alviniconcha gill DNA extracts by applying all the assays to 2 μl of each sample (in duplicate), which were compared against duplicate standard curves and no-template controls. A standard curve for each assay was constructed from linearized plasmid containing a representative 16S rRNA gene from the three symbiont phylotypes, diluted so that 101 to 107 gene copies were added per reaction.

Tracer incorporation into tissue samples and carbon fixation rates Approximately 300 mg symbiont-containing gill and symbiont-free foot tissue were subsampled while frozen for carbon isotopic analysis. Samples were lyophilized for 24 h and then were acidified with 0.1 N HCl to remove any unincorporated Na13CO3 contamination. The samples were subsequently dried for 24–48 h at 50–60°C, weighed to determine the dry weight, homogenized to a fine powder, and ~1 mg sealed within tin capsules. The carbon isotopic composition and percent carbon content was determined for foot tissue samples at Washington State University by combustion in an elemental analyzer (Eurovector, Inc.) and separating the evolved CO2 by gas chromatography before introduction to a Isoprime™ isotope ratio mass spectrometer (Micromass Inc). Gill tissue samples were assayed at the Yale Institute of Biospheric Studies’ Earth System Center for Stable Isotopic Studies using !
49

a ThermoFinnigan DeltaPLUS Advantage mass spectrometer (Thermo Scientific) coupled to a Costech ECS 4010 EA elemental analyzer (Costech Analytical Technologies). Measurements of isotopic composition are expressed as the atomic percent (%A = [13C/(13C+12C)] x 100%) and carbon contents expressed as a percentage of dry weight (%C). To obtain the percentage of 13C incorporated during these experiments (%13Cinc), the following formula was used: %13 Cinc =
A%g - A%f A%w - A%f

where A%g is the atomic percent of the gill tissue sample; A%f is the atomic percent of the same individual’s foot tissue sample; and A%w is the atomic percent of the input water DIC. The average isotopic composition of the foot tissue of each genus from all experiments was comparable to the natural isotopic composition of these animals (Table S4.2), indicating that 13C incorporation into foot tissue or contamination of the samples did not occur. Foot tissue was not sampled at the conclusion of the sulfide exposure treatment, so the average A%f from the other experiments was used to calculate rates for the individuals in this experiment (averages 1.076%, 1.075%, and 1.075% for Alviniconcha, I. nautilei and B. brevior, respectively). For the Alviniconcha individuals in the sulfide exposure treatment that hosted ε-proteobacterial symbionts, the A%f average from the previous experiments could not be used since Alviniconcha from the other experiments hosted γ-proteobacterial symbionts. For these individuals, the previously published average A%g (1.093%; (Beinart et al. 2012)) for ε-proteobacteria-hosting individuals was used since gill tissue is typically a reasonable approximation of the A%f in Alviniconcha (Y. Suzuki, Kojima, Sasaki, et al. 2006a). The weight of incorporated carbon (W13Cinc) was then calculated by multiplying the %13Cinc by the dry weight of the gill tissue (DWg) and the carbon content of the sample (%C).

!

50

Carbon incorporation rates (Cinc) are expressed as umoles 13C per gram of wet tissue per hour. This was first calculated as a rate of carbon incorporation expressed as umoles 13C per gram of dry tissue per hour (DryCinc) with the formula:

DryCinc =

[ W13 Cinc ! MWc × 1000] (DWg × t)

!

where MWc is the molecular weight of 13C; and t is the duration of the experiment. Cinc was then converted to Cinc by multiplying dryCinc by the ratio of DWg to the wet weight of that same sample (Wg).

Results Symbiont identity Via assessment of the symbiont populations through analysis of the 16S rRNA genes, we found that the symbionts of each host genus had low symbiont diversity. Except for a number of Alviniconcha from the sulfide exposure treatment, individuals from all three genera used in the incubations hosted γ-proteobacterial symbionts. Alviniconcha from the ELSC are known hosts to three phylotypes of symbionts: two γ-proteobacterial phylotypes (γ-1, γ-Lau) or an εproteobacterial phylotype. With the exception of some individuals in the sulfide exposure treatment, all experimental Alviniconcha were dominated by symbionts from one of the two γproteobacterial phylotypes (i.e., ≥93% of the detected 16S rRNA genes; Table S4.3). Most of these individuals hosted mainly γ-1 symbionts; only two individuals from the no sulfur experiment were dominated by γ-Lau symbionts. Among individuals of I. nautilei and B. brevior, there was low diversity in their symbionts as indicated by their 16S rRNA genes. Additionally, direct amplification and sequencing resulted in chromatograms with no evidence of mixed !
51

symbiont populations within individuals (data not shown). Individuals of I. nautilei yielded six unique sequences that are at least 99.5% identical to one another, while B. brevior individuals yielded three unique sequences that are at least 98.8% identical to one another. Bayesian phylogenetic analysis (Fig.4.2) showed that the experimental B. brevior symbiont sequences fell in a well-supported clade consisting of symbionts from Bathymodiolus mussels and Calyptogena clams and a few free-living marine bacteria. Experimental I. nautilei symbiont sequences fell in a wellsupported clade of I. nautilei symbionts from the Lau basin and other hydrothermal vent regions.

!

52

!
Figure 4.2: Bayesian inference phylogeny of γ-proteobacterial 16S rRNA gene sequences with β-proteobacterial outgroup. The symbionts of B. brevior and I. nautilei from all incubations are shown in bold with the number of individuals yielding that sequence indicated in brackets. Accession numbers are shown in parentheses. Posterior probabilities are indicated above the nodes if >0.7.

!

53

Table 4.1: Net sulfur uptake (oxidation) and excretion by the three mollusc genera. Number of individuals (n) and the total wet weight of gill tissue for each mollusc genus in each experiment, as well as the average (min, max) concentrations of sulfide, thiosulfate and polysulfides as measured via a voltammetric electrode in the effluent from each aquaria.

Experiment 0 5 5 4 0 15.9 18.8 18.8 0.20 (0.20, 0.20) 0.20 (0.20, 0.20) 0.20 (0.20, 0.20) 0.20 (0.20, 0.20) 30 (30,30) 30 (30,30) 30 (30,30) 30 (30,30)

Genus

Total gill n wet weight (g) Sulfide

Concentration in effluent (μM) Thiosulfate

Polysulfides 0.20 (0.20, 0.20) 0.20 (0.20, 0.20) 0.20 (0.20, 0.20) 0.20 (0.20, 0.20)

No sulfur

Control Alviniconcha I. nautilei B. brevior

Sulfide 0 5 5 4 0 3 4 3 0 21.4 19.5 13.5 0.32 (0.20, 1.1) 0.22 (0.20, 0.36) 0.22 (0.20, 0.31) 0.20 (0.20, 0.20) 0 22.6 20.5 18.4 66 (46, 107) 5.7 (2.7,9.7) 5.8 (3.0, 8.6) 3.0 (1.4, 3.9)

54

Control Alviniconcha I. nautilei B. brevior

30 (30,30) 30 (30,30) 30 (30,30) 30 (30,30) 276 (216, 310) 139 (30, 209) 42 (30, 70) 140 (67,188)

0.20 (0.20, 0.20) 0.20 (0.20, 0.20) 0.20 (0.20, 0.20) 0.20 (0.20, 0.20) 0.20 (0.20, 0.20) 0.20 (0.20, 0.20) 0.20 (0.20, 0.20) 0.20 (0.20, 0.20)

Thiosulfate

Control Alviniconcha I. nautilei B. brevior

!

Sulfur metabolism and carbon fixation in rate experiments All three symbioses demonstrated net sulfide and thiosulfate uptake (or oxidation; Table 4.1). Though seawater sulfur concentrations were depleted by the animals during the incubations (relative to the control vessel), measurable concentrations of sulfide and thiosulfate were detected in the vessel effluent during all experiments, suggesting that sulfur compounds did not become limiting in the experiments (sulfur limitation would prohibit the determination of
Figure 4.3: Average (±S.D.) mass specific net sulfur oxidation rates (μmoles of sulfur per gram of wet gill tissue per hour) during the sulfide (a) and thiosulfate (b) rate experiments for Alviniconcha (△), B. brevior (☐), and I. nautilei (◇).

mass-specific sulfur uptake rates). Average mass-specific net sulfide oxidation rates were comparable

among the three genera at these experimental conditions (Fig.4.3a). The average mass-specific net thiosulfate oxidation rates varied more among the three genera, with I. nautilei having almost twice the average rate of Alviniconcha (Fig.4.3b). Additionally, net thiosulfate oxidation rates fluctuated more widely over the duration of the experiment than did net sulfide oxidation rates (Fig.4.3a,b). Other than the provided sulfur species, no sulfur compounds were detected the effluent of the three experiments, indicating that sulfur excretion did not occur at these conditions.

!

55

Carbon incorporation (or fixation) was stimulated in the gills of individuals from all three symbiotic genera when provided sulfide, but only in Alviniconcha and I. nautilei individuals when given thiosulfate (Fig.4.4, Fig.S4.3). When supplied sulfide, carbon incorporation rates among the

Figure 4.4: Individual mass-specific carbon incorporation rates (μmoles of 13C per gram of wet gill tissue per hour) for Alviniconcha (A), I. nautilei (I), and B. brevior (B) during the no sulfur (a), sulfide (b), and thiosulfate (c) rate experiments.

genera did not differ significantly from one another (Kruskal-Wallis, p=0.424) (Fig.4.4b). Among all three experiments, the greatest rates of carbon fixation occurred in I. nautilei individuals supplied thiosulfate (Fig.4.4c), though I. nautilei did not differ significantly from Alviniconcha individuals in that experiment (Mann-Whitney U, p=0.114). Carbon fixation was not stimulated in Alviniconcha and I. nautilei individuals in the no sulfur (control) experiments, though minor carbon incorporation was detected in two of the four B. brevior individuals.

!

56

Sulfur metabolism and carbon fixation during exposure treatments Both sulfide and thiosulfate concentrations were depleted in the effluents of the experimental aquaria relative to the input water in their respective exposure treatments (Table 4.2). As with the rate experiments, measurable concentrations of sulfide and thiosulfate were detected in the experimental effluent in their respective treatments, indicating that the symbioses did not completely exhaust these compounds in the aquaria. Mass-specific rates of uptake (oxidation) calculated relative to the input water were comparable among treatments, though the average rate of sulfide oxidation was greater than the average rate of thiosulfate oxidation for all three genera (Table 4.2). Sustained sulfur excretion was observed throughout the duration of the sulfide treatment, but not during the thiosulfate treatment (Table 4.2).

!

57

Table 4.2: Net sulfur uptake (oxidation) and excretion by the three mollusc genera during exposure treatments. Number of individuals (n); the sum total wet weight of gill tissue for each mollusc genus; average (min, max) concentrations of sulfide, thiosulfate and polysulfides as measured via a voltammetric electrode in the effluent from each aquaria; average (± S.D.) rates of net oxidation or excretion (indicated as negative or positive values, respectively) as μmoles per gram of wet gill tissue per hour.

Genus NA 10 NA 36.9 Concentration (μM) Concentration (μM) Rate (μmoles g-1 h-1) Concentration (μM) Rate (μmoles g-1 h-1) Concentration (μM) Rate (μmoles g-1 h-1) 14 (12, 15) -7.4 ± 0.52 85 (76, 90) -7.2 ± 0.75 30 (30,30) 0 34 (30, 40) +0.10 ± 0.08 349 (329, 387) 21 (19, 23) -6.8 ± 0.50 30 (30,30) 73 (68, 77) +0.92 ± 0.05

n

Total gill wet weight (g) Sulfide

Thiosulfate Polysulfides 0.20 (0.20, 0.20) 0.20 (0.20, 0.20) 0 78 (0.2, 126) +2.2 ± 1.5 0.20 (0.20, 0.20) 0

Sulfide treatment

Input Alviniconcha

I. nautilei 5 34.1

58

B. brevior

6

39.9

Thiosulfate treatment NA Concentration (μM) Concentration (μM) Rate (μmoles g-1 h-1) Concentration (μM) Rate (μmoles g-1 h-1) Concentration (μM) Rate (μmoles g-1 h-1) 8 39.3 NA

Input

302 (251, 404) 40 (30, 82) -5.62 ± 1.22 0.20 (0.20, 0.20) 0 0.20 (0.20, 0.20) 0 44 (30, 60) -4.66 ± 0.93 103 (30, 162) -4.02 ± 0.84

0.20 (0.20, 0.20) 0.20 (0.20, 0.20) 0 0.20 (0.20, 0.20) 0 0.20 (0.20, 0.20) 0

Alviniconcha

0.20 (0.20, 0.20) 0.20 (0.20, 0.20) 0

I. nautilei

10

50.7

B. brevior 6 45.3

!

Alviniconcha and I. nautilei individuals from both the sulfide and thiosulfate exposure treatments incorporated carbon (Fig.4.5a,c,d,f; Fig.S4.3). No carbon incorporation was observed by B. brevior in the sulfide treatment (Fig.4.5b, Fig.S4.3), though, two of the six B. brevior individuals from the thiosulfate exposure treatment incorporated carbon (Fig.4.5e, Fig. S4.3). In both treatments, carbon incorporation rates were greatly variable but likely related to substrate limitation in the aquaria. Animals positioned in the aquaria closest to the input of water generally had the highest carbon fixation rates, though this trend is more pronounced in the sulfide treatment then the thiosulfate treatment. Additionally, individuals from these treatments demonstrated the highest rates of carbon fixation among all of the animals in either the rate experiments or exposure treatments. Alviniconcha and B. brevior individuals from the thiosulfate exposure treatment showed the highest rates of carbon fixation among all individuals of their genus. Additionally, an individual from the sulfide exposure

Figure 4.5 Individual mass-specific carbon incorporation rates (μmoles of 13C per gram of wet gill tissue per hour) during the exposure treatments. Sulfide exposure treatment with Alviniconcha (a), B. brevior (b), and I. nautilei (c); thiosulfate exposure treatment with Alviniconcha (d), B. brevior (e), and I. nautilei (f). Black symbols indicate Alviniconcha hosting ε-proteobacterial symbionts. Individuals are shown according to their relative position in the HPRS aquaria.

!

59

treatment had the highest carbon fixation rate for any I. nautilei.

Discussion The significance of thiosulfate oxidation for hydrothermal vent symbioses Here, we demonstrated, for the first time, that exogenous thiosulfate drove carbon fixation in intact symbioses between vent animals and intracellular symbionts. This has only previously been tested in the intact vent tubeworm Riftia pachyptila, which does not oxidize thiosulfate (and carbon fixation was not measured; (Wilmot & Vetter 1990)). In vitro studies of the intracellular symbionts of Bathymodiolus mussels and Calyptogena clams show that they can support carbon fixation with thiosulfate oxidation (Belkin et al. 1986; Wilmot & Vetter 1990; Fisher et al. 1987; Childress et al. 1991; Nelson et al. 1995). However, since many animals produce thiosulfate from sulfide as a detoxification mechanism (Grieshaber & Völkel 1998), these experiments left it ambiguous whether these symbionts were only able to utilize endogenous thiosulfate produced by their host, or if the intact symbioses could take up and use thiosulfate from their surroundings. Our results demonstrated that these three mollusc symbioses were clearly able to support carbon fixation through the uptake of exogenous thiosulfate. This discovery, along with previous work showing thiosulfate-based carbon fixation in the epibionts of vent crustaceans (Watsuji et al. 2012; Watsuji et al. 2010; Polz et al. 1998; Ponsard et al. 2012), expands our understanding the many ways in which vent symbioses can derive energy from chemical reductants. Sulfide oxidation is often considered the main driver of primary productivity by chemoautotrophs at these habitats (Amend et al. 2011). However, with respect to standard Gibbs free energies, the complete oxidation of thiosulfate with oxygen is comparable to the complete oxidation of HS- (-738.7 and -732.6 kJ mol substrate-1, respectively) (Kelly 1999). Moreover, in our experiments, individual, thiosulfate-dependent carbon fixation rates often met !
60

or exceeded individual mass-specific rates with approximately the same concentration of sulfide. Furthermore, thiosulfate is non-toxic and may be readily concentrated within the host’s or symbionts’ cells, leading to higher Gibbs energies resulting from an elevated concentration of the substrate. Thus, thiosulfate has the potential to be an important energy source for some hydrothermal vent symbioses, though the extent to which the ELSC symbioses (or others) selectively use thiosulfate over sulfide remains to be determined. The potential ecological importance of thiosulfate-fueled carbon fixation is emphasized by the results of our experiment without sulfur, which underscores that sustained access to exogenous reductants is necessary for the productivity of these symbioses. It has long been hypothesized that many vent symbioses can utilize stored, intracellular elemental sulfur granules when exogenous reductants are absent (Vetter 1985; Stein et al. 1988). However, we demonstrated that the absence of reduced sulfur compounds results in a cessation of carbon fixation in the ELSC symbioses. Instead of depending on stored compounds, flexible use of multiple sulfur compounds may enable vent symbioses to contend with the dynamic conditions at hydrothermal vents. Given the variability in access to vent fluid that they are likely to experience due to temporal and spatial fluid dynamics, the ability to use multiple reductants (e.g., both sulfide and thiosulfate) may relieve the energy limitation that could occur if a symbiosis was exclusively dependent on energy sources found only in venting fluid.

Sulfur oxidation by the mollusc symbioses at the ELSC Our experiments showed that all three tested symbiotic mollusc genera used both sulfide and thiosulfate to fuel carbon fixation, though their capacities for these metabolisms varied. The specific rates of sulfide oxidation we report are comparable to the previous findings of Henry et al. (2008). Our mass-specific sulfide oxidation rates were similar in magnitude to those reported with !
61

conditions analogous to our incubations, though our I. nautilei mass-specific carbon fixation rates were higher than previously reported. Since their rates are based on the net uptake of carbon dioxide, high rates of respiration by I. nautilei may have masked higher rates of carbon fixation in their experiments. Our isotopic labeling experiments suggest that I. nautilei may be as productive as Alviniconcha at our experimental conditions, e.g., when sulfide and oxygen are replete. Previous work on the distribution of ELSC symbioses has suggested that the use of thiosulfate by the mussel B. brevior may play a role in its distribution. In particular, it was hypothesized that thiosulfate may be especially important for B. brevior physiological intolerance to high sulfide concentrations or temperature may prevent it from inhabiting areas of high fluid exposure (Waite et al. 2008). Consequently, thiosulfate oxidation may enable exploitation of habitat away from the venting fluid, where sulfide concentrations are typically low to undetectable but thiosulfate concentrations are elevated. While we observed that B. brevior can indeed use thiosulfate to power carbon fixation, only two of the nine total individuals tested incorporated the tracer (Fig.4.3,4.4), suggesting an inefficient coupling between the metabolisms. Therefore, determining the relative significance of this energy source to B. brevior’s overall productivity will require further work. We did, however, observe relatively high mass-specific rates of thiosulfate-dependent carbon fixation in both I. nautilei and Alviniconcha. These snails typically live in closer proximity to the venting source, where sulfide is more abundant and thiosulfate concentrations are low (Podowski et al. 2010; Waite et al. 2008; Gartman et al. 2011). Regardless, the data clearly reveal a robust coupling between thiosulfate oxidation and carbon fixation in I. nautilei and Alviniconcha. Consequently, the observation that I. nautilei and Alviniconcha commonly inhabit regions of low thiosulfate may simply reflect removal of thiosulfate via oxidation. This supposition is supported

!

62

by the observed increase in thiosulfate concentrations when Alviniconcha and I. nautilei were removed from snail and mussel aggregations in situ (Mullaugh et al. 2008).

Variability in carbon fixation rate and substrate limitation in the aquaria Use of an isotopic label to assess carbon fixation rates among the population of individuals in each exposure treatment revealed striking patterns in the carbon fixation rates that likely reflect substrate limitation in the aquaria seawater. Most previous experiments measuring the rates of carbon fixation by intact hydrothermal vent symbioses have been performed on low numbers of individuals, most often one at a time (Girguis & Childress 2006; Childress et al. 1991; Wilmot & Vetter 1990; Henry et al. 2008), and used the resulting change in chemical composition and the total biomass to estimate mass-specific metabolic rates. Here, the use of stable isotopically labeled inorganic carbon in our aquarium seawater allowed us to examine the variability in productivity among individuals; in our exposure treatments, we interrogated the mass-specific rates of carbon fixation for between five and ten individuals per genus. We found that the most productive animals in each aquarium likely accounted for much of the sulfur oxidation occurring in each during the exposure treatments. Using the molar ratios of 6.21 and 6.64 for the amount of carbon fixed per sulfide or thiosulfate (Kelly 1999) with an assumed 10% efficiency of energy conservation, we calculated the predicted rate of sulfur oxidation by the most productive animals in each aquarium from their individual rates of carbon fixation. In the sulfide exposure treatment, sulfide oxidation by the two most productive individuals may have accounted for 27% and 51% of the total oxidation in the Alviniconcha and I. nautilei aquaria, respectively. In the thiosulfate exposure treatment, oxidation by the productive individuals (all other individuals showed no carbon incorporation) may have accounted for 100% and 64% (Alviniconcha and I. nautilei, respectively) of the total oxidation in each aquarium. !
63

The striking disparity in mass-specific carbon fixation rates among individuals was unlikely to be linked to biological diversity (e.g., differences in symbiont populations), but alternatively may be due to individual differences in access to resources in the aquaria. Based on 16S rRNA gene sequences, all I. nautilei and B. brevior symbionts were very closely related. Except for some symbionts in the sulfide exposure treatment and no sulfur rate experiment, the symbionts of the Alviniconcha in our incubations were from one phylotype (γ-1). Instead, we discovered that the individuals closest to the input of water incorporated the greatest amount of carbon, and those near the outflow showed no measurable carbon incorporation, indicating that the most productive individuals near the input were limiting some substrate for those downstream. This pattern was clearly seen in the exposure treatments (Fig.4.4). Because both sulfur and oxygen were not completely depleted in the effluent, it is unclear which of these substrates, or any other substrate for that matter, was restricting the productivity of the symbioses. Moreover, it is plausible that waste-products from the more productive individuals may have inhibited productivity by those located downstream, though it is unclear what those waste-products might be (the predominant waste-products of chemoautotrophic sulfide oxidation are oxidized sulfur compounds and hydrogen ions) (Girguis, Childress, Freytag, et al. 2002; Girguis & Childress 1998). Our results have important implications for our understanding of total productivity of assemblages of these organisms in their habitats, particularly if the observed variability in carbon fixation rates is due to sulfur limitation. Large communities of these symbioses are often found piled around hydrothermal vent orifices, often two to seven animals deep (C. Fisher, pers. comm.). In these piles, an individual’s access to sulfide (or any vent-derived substrate) is governed by the confluence of end-member concentration, fluid flow rate, and animal/microbial uptake rate. In situ populations are likely experiencing gradients in vent-derived geochemistry resulting !
64

from the net effect of biotic and abiotic factors. Our data suggest that competition for ventderived resources, which is tied to spatial position in the fluid flow relative other individuals, may be significant for these symbioses. Interestingly, these results also provide another perspective from which to view thiosulfate-driven autotrophy in these ecosystems. At the tops of the assemblages, where vent-derived reductants may be depleted by the activity of those below, use of an energy source that is not sourced from venting fluid could sustain productivity. Therefore, metabolic flexibility has the potential to relieve competition for vent-derived reductants, both within and between genera.

Excretion of sulfur compounds Though links between the distribution of particular ELSC symbioses and elevated concentrations of partially oxidized sulfur may indicate a preference for that particular geochemical niche, it is also possible that such correlation may be the result from excretion of that compound by the associated symbioses. To address the potential for sulfur excretion by the ELSC symbioses, we measured the production of partially oxidized sulfur in our incubations. Our sulfide exposure treatment showed that these symbioses have the potential to contribute to the partially oxidized sulfur pools in their environment. During the ~350 μM sulfide exposure treatment, the snail I. nautilei released polysulfides (as previously described in Gartman et al., (2011). Additionally, both Alviniconcha and B. brevior excreted thiosulfate, though the mass-specific rate was nine times higher in Alviniconcha. Since our incubations were performed on intact symbioses, we are unable to discern which partner, host or symbiont, is the source of the excreted sulfur. Many invertebrates, even those without chemoautotrophic symbionts, detoxify sulfide via oxidation to thiosulfate with their mitochondria (Grieshaber & Völkel 1998). Because we did not observe sulfur excretion in the other incubation with a lower sulfide concentration (i.e., the rate !
65

experiment with a ~105 μM sulfide), this could be the case. Additionally, B. brevior did not fix carbon when exposed to ~350 μM sulfide, though sulfide oxidation was observed. The sulfide concentration in this treatment was much higher than what B. brevior would experience in situ (Podowski et al. 2009; Podowski et al. 2010; Sen et al. 2013), thus it is possible that it was oxidizing sulfide to thiosulfate as a detoxification mechanism. It is also conceivable that the excreted partially oxidized sulfur was the product of sulfide oxidation by the symbionts of these animals. Experiments with the sulfur-oxidizing isolate Thiobacillus thioparus showed that both thiosulfate and polysulfides can be produced via sulfide oxidation when oxygen is limiting (van den Ende & Gemerden 1993). Though >5 μM oxygen was always detected in the effluent of the aquaria (data not shown), respiration by the high biomass in the exposure treatment could have caused low concentrations in the aquaria, resulting in high sulfide to oxygen ratios. In addition, the symbionts of the vent tubeworm Riftia pachyptila produce polysulfides from the oxidation of sulfide in vitro (Wilmot & Vetter 1990), though this is thought to be a normal intermediate during the production of sulfur granules as it is with other sulfide oxidizers (Dahl & Prange 2006). Regardless of the partner of origin, net excretion of partially oxidized sulfur by these symbioses reveals a biological source for these compounds in situ. High polysulfide concentrations are detected around I. nautilei and Alviniconcha at the ELSC, while high thiosulfate concentrations are found around B. brevior (Gartman et al. 2011; Waite et al. 2008; Mullaugh et al. 2008). It was suggested previously that these partially oxidized sulfur compounds result from the abiotic oxidation of sulfide in venting fluid by aqueous iron or rocky substrate, or from biological oxidation by the symbioses. Here, we demonstrate that biological oxidation may influence the presence of these sulfur compounds, ultimately affecting the local sulfur regime. Since both freeliving microbes and vent symbioses can use these compounds for autotrophy, biological sulfur !
66

transformations have the potential to affect the distribution and activities of many organisms within these ecosystems.

Conclusions The extent to which vent symbioses can use exogenous thiosulfate to drive autotrophy remains unknown, though genomic analyses of the symbionts of vent organisms has revealed that many possess the metabolic pathway for the oxidation of sulfur, including thiosulfate (Kleiner et al. 2012; Newton et al. 2007; Kuwahara et al. 2007; Robidart et al. 2008; Nakagawa et al. 2013; Gardebrecht et al. 2011). Thiosulfate concentrations at vent habitats have only been extensively surveyed at the ELSC. However, given the rapid abiotic oxidation of sulfide to thiosulfate in the presence of certain metals (Santos Afonso & Stumm 1992; Pyzik & Sommer 1981), as well as the potential for some symbioses to contribute to pools of partially oxidized sulfur, it is likely that it is also present in other systems. Thiosulfate-fueled autotrophy has ecological benefits, particularly for symbioses that cannot be near the high concentrations of reductants in venting fluid, either due to physiological intolerance to high temperatures or toxic vent chemicals, or because of competitive exclusion. Additionally, flexible use of multiple reductants may help vent symbioses cope with periods of low exposure to reductants in vent fluid that result from the temporal and spatial inconsistency of these habitats. Though we showed that access to particular sulfur compounds differentially affects the productivity of these symbioses, the ability of all three, coexisting genera to fuel autotrophy with both sulfide and thiosulfate indicates that metabolic flexibility has important advantages in these ecosystems. Altogether, these experiments broaden our understanding of sulfur metabolism in animalbacterial symbioses at hydrothermal vents. Though it has long been expected that vent symbioses can alter the local geochemical regime through the uptake and oxidation of sulfide, the observed !
67

excretion of partially oxidized sulfur suggests a new mode for these associations to affect their ecosystem. Since the discovery of hydrothermal vents, sulfide has been known to play a fundamental role in structuring and supporting vent assemblages (Fisher et al. 2007); here, our data suggests that the influence of vent symbioses on sulfur biogeochemical cycling extends beyond the acquisition and oxidation of sulfide, and the resulting production of sulfate. Rather, these symbioses may be influencing the availability of partially oxidized sulfur compounds that are of energetic value to the free-living microbes that live in these ecosystems. While tubeworm symbioses have previously been described as ecosystems engineers for the role they play in shaping the physical structure of their environment, these data extend that role and illustrate the extent to which they might govern the local sulfur regime.

Acknowledgements This material is based upon work supported by the National Science Foundation (GRF grant no. DGE-1144152 to RAB, OCE-0732439 to GWL, and OCE-0732369 to PRG). We are grateful for the crews of the RV Thomas G. Thompson and the ROV JASON II for their support. We thank A. Thomsen, R. Hussey and T. Galyean for their assistance with the sulfide measurements from our discrete samples; and G. Hunsinger from the Yale Institute of Biospheric Studies’ Earth System Center for Stable Isotopic Studies.

!

68

References Amend, J.P. et al., 2011. Catabolic and anabolic energy for chemolithoautotrophs in deep-sea hydrothermal systems hosted in different rock types. Geochimica Et Cosmochimica Acta, 75(19), pp.5736–5748. Beinart, R.A. et al., 2012. Evidence for the role of endosymbionts in regional-scale habitat partitioning by hydrothermal vent symbioses. Proceedings of the National Academy of Sciences. Online only. Belkin, S., Nelson, D.C. & Jannasch, H.W., 1986. Symbiotic assimilation of CO2 in the two hydrothermal vent animals, the mussel Bathymodiolus thermophilus and the tubeworm Riftia pachyptila. Biol Bull, 170(1), pp.110–121. Brendel, P.J. & Luther, G., 1995. Development of a gold amalgam voltammetric microelectrode for the determination of dissolved Fe, Mn, O2, and S (-II) in porewaters of marine and freshwater sediments. Environmental Science & Technology, 29(3), pp.751-761 Childress, J.J. & Mickel, T.J., 1980. A motion compensated shipboard precision balance system. Deep Sea Research Part A. Oceanographic Research Papers, 27(11), pp.965–970. Childress, J.J. et al., 1991. Sulfide and carbon dioxide uptake by the hydrothermal vent clam, Calyptogena magnifica, and its chemoautotrophic symbionts. Physiological Zoology, 64(6), pp.1444–1470. Childress, J.J. et al., 1998. The role of a zinc-based, serum-borne sulphide-bidning component in the uptake and transport of dissolved sulphide by the chemoautotrophic symbiont-containing clam Calyptogena elongata. J Exp Biol, 179(1), pp.131–158. Cline, J.D., 1969. Spectrophotometric determination of hydrogen sulfide in natural waters. Limnol. Oceanogr., 14, pp.454–458. Dahl, C. & Prange, A., 2006. Bacterial sulfur globules: occurrence, structure and metabolism. Inclusions in Prokaryotes. Shively, J.M. (ed.). Heidelberg: Springer-Verlag, pp. 21–51. Dando, P.R., Southward, A.J. & Southward, E.C., 1986. Chemoautotrophic symbionts in the gills of the bivalve mollusc Lucinoma borealis and the sediment chemistry of its habitat. Proceedings of the Royal Society B-Biological Sciences, 227(1247), pp.227–247. Dubilier, N., Windoffer, R. & Giere, O., 1998. Ultrastructure and stable carbon isotope composition of the hydrothermal vent mussels Bathymodiolus brevior and B. sp. affinis brevior from the North Fiji Basin, western Pacific. Marine Ecology Progress Series, 165, pp.187– 193. Fisher, C.R. et al., 1987. The importance of methane and thiosulfate in the metabolism of the bacterial symbionts of two deep-sea mussels. Marine Biology, 96(1), pp.59–71. Fisher, C.R., Takai, K. & Le Bris, N., 2007. Hydrothermal vent ecosystems. Oceanography,

!

69

20(1), pp.14–23. Gardebrecht, A. et al., 2011. Physiological homogeneity among the endosymbionts of Riftia pachyptila and Tevnia jerichonana revealed by proteogenomics. 6(4), pp.766–776. Gartman, A. et al., 2011. Sulfide oxidation across diffuse flow zones of hydrothermal vents. Aquatic Geochemistry, 17(4-5), pp.583–601. Giere, O. et al., 1988. Contrasting effects of sulfide and thiosulfate on symbiotic CO2assimilation of Phallodrilus leukodermatus (Annelida). Marine Biology, 97(3), pp.413–419. Girguis, P.R. & Childress, J.J., 1998. H+ equivalent elimination by the tube-worm Riftia pachyptila. Cahiers De Biologie Marine, 39(3-4), pp.295–296. Girguis, P.R. & Childress, J.J., 2006. Metabolite uptake, stoichiometry and chemoautotrophic function of the hydrothermal vent tubeworm Riftia pachyptila: responses to environmental variations in substrate concentrations and temperature. Journal of Experimental Biology, 209(18), pp.3516–3528. Girguis, P.R. et al., 2000. Fate of nitrate acquired by the tubeworm Riftia pachyptila. Applied and Environmental Microbiology, 66(7), pp.2783–2790. Girguis, P.R., Childress, J.J., Freytag, J.K., et al., 2002. Effects of metabolite uptake on protonequivalent elimination by two species of deep-sea vestimentiferan tubeworm, Riftia pachyptila and Lamellibrachia cf luymesi: proton elimination is a necessary adaptation to sulfide-oxidizing chemoautotrophic symbionts. Journal of Experimental Biology, 205(19), pp.3055–3066. Grieshaber, M.K. & Völkel, S., 1998. Animal adaptations for tolerance and exploitation of poisonous sulfide. Annual Review of Physiology, 60, pp.33–53. Gru, C. et al., 1998. Determination of reduced sulfur compounds by high-performance liquid chromatography in hydrothermal seawater and body fluids from Riftia pachyptila. The Analyst, 123(6), pp.1289–1293. Henry, M.S., Childress, J.J. & Figueroa, D., 2008. Metabolic rates and thermal tolerances of chemoautotrophic symbioses from Lau Basin hydrothermal vents and their implications for species distributions. Deep Sea Research Part I: Oceanographic Research Papers, 55(5), pp.679–695. Huelsenbeck, J.P. & Ronquist, F.R., 2001. MRBAYES: Bayesian inference of phylogeny. Bioinformatics, 17, pp.754–755. Kelly, D.P., 1999. Thermodynamic aspects of energy conservation by chemolithotrophic sulfur bacteria in relation to the sulfur oxidation pathways. Archives of Microbiology, 171(4), pp.219–229. Kleiner, M., Petersen, J.M. & Dubilier, N., 2012. Convergent and divergent evolution of metabolism in sulfur-oxidizing symbionts and the role of horizontal gene transfer. Current

!

70

Opinion in Microbiology, 15(5), pp.621–631. Kuwahara, H. et al., 2007. Reduced Genome of the Thioautotrophic Intracellular Symbiont in a Deep-Sea Clam, Calyptogena okutanii. Current Biology, 17(10), pp.881–886. Lane, D.J., 1991. 16S/23S rRNA sequencing E. Stackebrandt, M. Goodfellow, & undefined author, eds., New York: J. Wiley and Sons. Luther III, G.W. et al., 2001. Sulfur speciation monitored in situ with solid state gold amalgam voltammetric microelectrodes: polysulfides as a special case in sediments, microbial mats and hydrothermal vent waters. Journal of Environmental Monitoring, 3(1), pp.61–66. Luther III, G.W. et al., 2001. Chemical speciation drives hydrothermal vent ecology. Nature, 410(6830), p.813. Mullaugh, K.M. et al., 2008. Voltammetric (Micro)Electrodes for the In Situ Study of Fe2+ Oxidation Kinetics in Hot Springs and S2O Production at Hydrothermal Vents. Electroanalysis, 20(3), pp.280–290. Nakagawa, S. et al., 2013. Allying with armored snails- the complete genome of gammaproteobacterial endosymbiont. pp.1–12. Nelson, D.C. & Hagen, K.D., 1995. Physiology and biochemistry of symbiotic and free-living chemoautotrophic sulfur bacteria. Amer. Zool., 35(2), pp.91–101. Nelson, D.C., Hagen, K.D. & Edwards, D.B., 1995. The gill symbiont of the hydrothermal vent mussel Bathymodiolus thermophilus is a psychrophilic, chemoautotrophic, sulfur bacterium. Marine Biology, 121(3), pp.487–495. Newton, I.L.G. et al., 2007. The Calyptogena magnifica chemoautotrophic symbiont genome. Science (New York, N.Y.), 315(5814), pp.998–1000. Petersen, J.M. et al., 2011. Hydrogen is an energy source for hydrothermal vent symbioses. Nature, 476(7359), pp.176–180. Plummer, M. et al., 2006. CODA: convergence diagnosis and output analysis for MCMC. R News, 6(1), pp.7–11. Podowski, E.L. et al., 2010. Biotic and abiotic factors affecting distributions of megafauna in diffuse flow on andesite and basalt along the Eastern Lau Spreading Center, Tonga. Marine Ecology Progress Series, 418, pp.25–45. Podowski, E.L. et al., 2009. Distribution of diffuse flow megafauna in two sites on the Eastern Lau Spreading Center, Tonga. Deep-Sea Research Part I, 56(11), pp.2041–2056. Polz, M.F. et al., 1998. Trophic ecology of massive shrimp aggregations at a Mid-Atlantic Ridge hydrothermal vent site. Limnology and Oceanography, 43(7), pp.1631–1638. Ponsard, J. et al., 2012. Inorganic carbon fixation by chemosynthetic ectosymbionts and !
71

nutritional transfers to the hydrothermal vent host-shrimp Rimicaris exoculata. The ISME journal, 7(1), pp.96–109. Pruesse, E., Peplies, J. & Glöckner, F.O., 2012. SINA: accurate high-throughput multiple sequence alignment of ribosomal RNA genes. Bioinformatics. Pyzik, A.J. & Sommer, S.E., 1981. Sedimentary iron monosulfides: Kinetics and mechanism of formation. Geochimica Et Cosmochimica Acta. Robidart, J.C. et al., 2008. Metabolic versatility of the Riftia pachyptila endosymbiont revealed through metagenomics. Environmental microbiology, 10(3), pp.727–737. Robinson, J.J. et al., 1998. Physiological and immunological evidence for two distinct C1utilizing pathways in Bathymodiolus puteoserpentis (Bivalvia: Mytilidae), a dual endosymbiotic mussel from the Mid-Atlantic Ridge. Marine Biology, 132(4), pp.625–633. Santos Afonso, Dos, M. & Stumm, W., 1992. Reductive dissolution of iron (III)(hydr) oxides by hydrogen sulfide. Langmuir, 8, pp.1671–1675 Schmidt, C. et al., 2008. Geochemical energy sources for microbial primary production in the environment of hydrothermal vent shrimps. Marine Chemistry, 108(1-2), pp.18–31. Scott, K.M. & Cavanaugh, C.M., 2007. CO2 Uptake and Fixation by Endosymbiotic Chemoautotrophs from the Bivalve Solemya velum. Applied and Environmental Microbiology, 73(4), pp.1174–1179. Sen, A. et al., 2013. Distribution of mega fauna on sulfide edifices on the Eastern Lau Spreading Center and Valu Fa Ridge. Deep Sea Research Part I: Oceanographic Research Papers, 72, pp.48–60. Sievert, S. & Vetriani, C., 2012. Chemoautotrophy at deep-sea vents: past, present, and future. Oceanography, 25(1), pp.218–233. Stein, J.L. et al., 1988. Chemoautotrophic symbiosis in a hydrothermal vent gastropod. Biological Bulletin, 174(3), pp.373–378. Stewart, F.J.F., Newton, I.L.G.I. & Cavanaugh, C.M.C., 2005. Chemosynthetic endosymbioses: adaptations to oxic-anoxic interfaces. Trends in Microbiology, 13(9), pp.439–448. Suzuki, Y., Kojima, S., Sasaki, T., et al., 2006a. Host-symbiont relationships in hydrothermal vent gastropods of the genus Alviniconcha from the Southwest Pacific. Applied and Environmental Microbiology, 72(2), pp.1388–1393. Suzuki, Y., Kojima, S., Watanabe, H., et al., 2006b. Single host and symbiont lineages of hydrothermal vent gastropods Ifremeria nautilei (Provannidae): biogeography and evolution. Marine Ecology Progress Series, 315, pp.167–175. Suzuki, Y., Sasaki, T., Suzuki, M., Nogi, Y., et al., 2005a. Novel chemoautotrophic

!

72

endosymbiosis between a member of the Epsilonproteobacteria and the hydrothermal-vent gastropod Alviniconcha aff. hessleri (Gastropoda : Provannidae) from the Indian Ocean. Applied and Environmental Microbiology, 71(9), pp.5440–5450. Suzuki, Y., Sasaki, T., Suzuki, M., Tsuchida, S., et al., 2005b. Molecular phylogenetic and isotopic evidence of two lineages of chemo auto trophic endosymbionts distinct at the subdivision level harbored in one host-animal type: The genus Alviniconcha (Gastropoda : Provannidae). Fems Microbiology Letters, 249(1), pp.105–112. Teske, A. et al., 2000. Diversity of thiosulfate-oxidizing bacteria from marine sediments and hydrothermal vents. Applied and Environmental Microbiology, 66(8), pp.3125–3133. van den Ende, F.P. & Gemerden, H.V., 1993. Sulfide oxidation under oxygen limitation by a Thiobacillus thioparus isolated from a marine microbial mat. FEMS Microbiology Ecology, 13(1), pp.69–77. Vetter, R.D., 1985. Elemental sulfur in the gills of three species of clams containing chemoautotrophic symbiotic bacteria: a possible inorganic energy storage compound. Marine Biology. Waite, T.J. et al., 2008. Variation in sulfur speciation with shellfish presence at a Lau Basin diffuse flow vent site. Journal of Shellfish Research, 27(1), pp.163–168. Watsuji, T.-O. et al., 2010. Diversity and function of epibiotic microbial communities on the galatheid crab, Shinkaia crosnieri. Microbes and Environments, 25(4), pp.288–294. Watsuji, T.-O., et al., 2012. Cell-Specific Thioautotrophic Productivity of EpsilonProteobacterial Epibionts Associated with Shinkaia crosnieri S. Bertilsson, ed. PLoS ONE, 7(10), p.e46282. Wilmot, D.B., Jr & Vetter, R.D., 1990. The bacterial symbiont from the hydrothermal vent tubeworm Riftia pachyptila is a sulfide specialist. Marine Biology, 106(2), pp.273–283.

!

73

Chapter 5 Intracellular Oceanospirillales among the chemosynthetic symbionts of the hydrothermal vent snail Alviniconcha: secondary symbionts or parasites?

(formatted for journal submission)

Summary Associations between bacteria from the γ-proteobacterial order Oceanospirillales and invertebrates are increasingly recognized as common in marine habitats. Members of the Oceanospirillales exhibit a diversity of interactions with their various hosts, ranging from the catabolism of complex compounds that benefit host growth to attacking and bursting host nuclei. Here, we describe the association between a novel, intracellular Oceanospirillales phylotype and the hydrothermal vent snail Alviniconcha. Alviniconcha typically harbor chemoautotrophic γ- or εproteobacterial symbionts, but we also observed (via fluorescence in situ hybridization and transmission electron microscopy) this Alviniconcha Oceanospirillales phylotype (AOP) among the dense populations of proteobacterial symbionts that Alviniconcha host inside their gill cells. Notably, AOP were separately contained in membrane-bound vacuoles. Using AO-specific quantitative PCR, we surveyed 283 Alviniconcha individuals, and found that AOP occurred more frequently and at greater abundance in Alviniconcha hosting γ-proteobacterial symbionts. However, the population size of AOP was always minor relative to those of the canonical symbionts. The high incidence of AOP in γ-proteobacteria hosting Alviniconcha implies that it could play a significant ecological role for these snails either as a host parasite or as an additional symbiont with unknown physiological capacities.

Introduction In recent years, lineages from the γ-proteobacterial order Oceanospirillales have emerged as widespread associates of marine invertebrates. In shallow-water habitats, Oceanospirillales are common and even dominant members of the tissue and mucus-associated microbiota of temperate and tropical corals (Bourne et al., 2013; Bayer, Arif, et al., 2013; Bayer, Neave, et al., 2013; La Rivière et al., 2013; Sunagawa et al., 2010; Chen et al., 2013) and sponges (Bourne et !
75

al., 2013; Nishijima et al., 2013; Bayer, Arif, et al., 2013; Kennedy et al., 2008; Bayer, Neave, et al., 2013; Flemer et al., 2011; La Rivière et al., 2013; Sunagawa et al., 2010; Chen et al., 2013), and they have been detected in the gills of commercially important shellfish (Costa et al., 2012), as well as invasive oysters (Zurel et al., 2011). In deep-water habitats, Oceanospirillales have been found in association with hydrothermal vent and hydrocarbon seep bivalves (Jensen et al., 2010; Zielinski et al., 2009), polychaete worms and gastropods from whale carcasses (Johnson et al., 2010; Goffredi et al., 2005; Verna et al., 2010). In almost all cases, the nature of these animalbacterial relationships remains undetermined. Cultivated members of the Oceanospirillales are heterotrophs known for their abilities to degrade complex organic compounds (Garrity et al., 2005). Thus, hypotheses about the function of animal-associated Oceanospirillales have ranged from parasitic consumers of host tissue to beneficial symbionts that assist in the metabolism or cycling of organic compounds. Two well-characterized examples from the deep-sea show that Oceanospirillales can be either beneficial or harmful to their hosts. In bone-eating Osedax worms found at whale-falls, Oceanospirillales are intracellular symbionts thought to assist in the digestion of bone-derived organic compounds (Goffredi et al., 2005). In contrast, bacteria from another lineage of Oceanospirillales are parasites of Bathymodiolus mussels from hydrothermal vent and cold seeps, proliferating in and bursting host nuclei (Zielinski et al., 2009). These cases demonstrate the range of interactions that Oceanospirillales can mediate with marine invertebrates. Here, we report a novel Oceanospirillales phylotype discovered in a general survey of the bacterial community associated with gill tissue of the hydrothermal vent snail Alviniconcha. Alviniconcha are dominant members of the animal communities at hydrothermal vents in the south-western Pacific and Indian Ocean (Desbruyeres et al., 1994; Podowski et al., 2009; 2010; Van Dover et al., 2001; Ramirez-Llodra et al., 2007). This symbiotic genus is comprised of at !
76

least five lineages (likely species) that are supported by the productivity of chemoautotrophic bacterial symbionts, which utilize the reductants in emitted fluid for the energy to fix inorganic carbon (Henry et al., 2008; Y. Suzuki, Sasaki, M. Suzuki, Tsuchida, et al., 2005; Y. Suzuki, Sasaki, M. Suzuki, Nogi, et al., 2005; Y. Suzuki et al., 2006; Sanders et al., 2013). Dense populations of the bacterial symbionts reside intracellularly in Alviniconcha gill tissue and provide the bulk of host nutrition (Y. Suzuki, Sasaki, M. Suzuki, Tsuchida, et al., 2005; Y. Suzuki, Sasaki, M. Suzuki, Nogi, et al., 2005). Alviniconcha snails are typically dominated by one γ- or εproteobacterial phylotype according to their species, although individuals from one of these species harbor relatively equal populations of two distinct γ-proteobacterial phylotypes (Beinart et al., 2012). On the basis of molecular surveys and microscopic examination, we describe the phylogenetic relationship of a novel, Alviniconcha-associated Oceanospirillales phylotype to other lineages in this order, localize it inside the gill cells of Alviniconcha, and report its frequency and abundance across a population of Alviniconcha from hydrothermal vents at the Eastern Lau Spreading Center.

Results and Discussion Identification and phylogeny of an Oceanospirillales phylotype in Alviniconcha Alviniconcha specimens were obtained from four Lau Basin hydrothermal vent fields, which are separated by 10s of kilometers along the approximately 300 kilometer north-south Eastern Lau Spreading Center (ELSC). The bacterial communities associated with the gills of ELSC Alviniconcha were surveyed by amplifying and sequencing 16S rRNA gene sequences from the pooled tissue DNA of 30 individuals recovered from two vent fields (as described in Beinart et al., 2012). While sequences with affiliation to previously known Alviniconcha ε- and γ-proteobacterial symbiont phylotypes dominated the survey (Beinart et al., 2012), we also observed a novel !
77

phylotype from the γ-proteobacterial order Oceanospirillales (hereafter referred to as ‘AOP’ for ‘Alviniconcha Oceanospirillales phylotype’). To augment the clone library, we used BLASTN (Altschul et al., 1990) to search for AOP in 16S rRNA pyrosequence libraries from four Alviniconcha individuals (Sanders et al., 2013). This revealed only one matching operational taxonomic unit (OTU) that comprised of sequences with ≥ 97% identity to our AOP sequence. One other OTU was taxonomically characterized as an Oceanospirillales, but only comprised of two, comparatively short sequence reads (94% identity to the AOP sequence). To ascertain the relationship of AOP to other Oceanospirillales (and, more broadly, the γ-proteobacteria), Bayesian inference was used to construct a phylogeny of 16S rRNA genes (Fig.5.1). AOP falls within a well-supported clade of Oceanospirillales that have all, with the exception of one clone, been found in association with diverse marine invertebrates from various habitats. The closest relatives of AOP are clones recovered from tropical, shallow-water corals from the Caribbean (Sunagawa et al., 2010) and the Great Barrier Reef (Bourne and Munn, 2005). The few cultivated representatives from this clade are members of the genera Endozoicomonas and Spongiobacter, which have been isolated from sea slugs (Kurahashi and Yokota, 2007), corals (Bayer, Arif, et al., 2013; Yang et al., 2010; Raina et al., 2009), and sponges (Nishijima et al., 2013; Flemer et al., 2011). Though there is increasing evidence that this clade of Oceanospirillales is specific to marine invertebrates, the relationship between its members and their animal hosts, as well as their location in or on host tissue, is, as yet, uncharacterized. A notable exception is “Candidatus Endonucleobacter bathymodiolii”, a parasite of hydrothermal vent mussels that has been shown to infect host nuclei, multiply and eventually burst from the organelle (Zielinski et al., 2009). The AOP 16S rRNA gene has 95% sequence identity to a “Ca. E. bathymodiolii” 16S rRNA gene sequence recovered from a Gulf of Mexico cold seep mussel.

!

78

79

Figure 5.1: A Bayesian inference phylogeny of 16S rRNA gene sequences showing the relationship of AOP (indicated with an arrow) to other Oceanospirillales, the chemoautotrophic symbionts of Alviniconcha and other animals, and the sequences from the out-group βproteobacteria. All Alviniconcha-associated sequences are shown in bold. Gray highlighting indicates that the clone or strain has been found in association with a marine invertebrate. Posterior probabilities are indicated above the nodes if >0.7.

Localization of AOP in Alviniconcha gill tissue To localize AOP in Alviniconcha gill tissue, we examined Alviniconcha individuals via fluorescence in situ hybridization (FISH) using universal
40

A

bacterial and AOP-specific probes targeting 16S rRNA (Fig.5.2), as well as used transmission electron microscopy (TEM) to describe its morphology in association with Alviniconcha gills (Fig.5.3, 5.4). Three

5

B

animals hosting γ-proteobacterial symbionts and three animals hosting ε-proteobacterial symbionts were selected for these analyses.

50

C

Figure 5.2: Identification of AOP (yellow) and all bacteria (red), including the chemoautotrophic symbionts, in Alviniconcha gill tissue with fluorescence in situ hybridization. Additionally, DNA-containing organelles or cells were stained with DAPI and shown in blue. (A) Gill filaments of Alviniconcha hosting γproteobacterial symbionts with AOP-containing vacuoles distributed sporadically. (B) A typical AOP vacuole. (C) Gill filament of Alviniconcha hosting εproteobacterial symbionts, with no AOP-containing vacuoles. All scale bars are shown in μm.

!

80

A

n

B

D

1 s

C
0.5 1

10

Figure 5.3: Transmission electron micrographs of the γ-proteobacterial symbionts of Alviniconcha. (A) One side of a gill filament, showing bacteriocytes, but no suspected AOPcontaining vacuoles. n, host nuclei; s, symbiont cells. (B), (C) and (D) show the two symbiont morphotypes, distinguished by white and black arrows. All scale bars are shown in μm.

Examination of Alviniconcha gills using FISH confirmed the presence of AOP inside host cells, though there was no evidence of their presence in host nuclei (Fig.5.2a,b). Via FISH, AOP was found to be present only in the gills of the γ-proteobacteria-hosting snails and not in the εhosting individuals (Fig.5.2a,c). We consistently found AOP populations localized in vacuoles, approximately 10 - 40 μm in diameter, which were sporadically distributed throughout the gill filaments in symbiont-containing cells (bacteriocytes). Unlike the filamentous and rod-shaped symbionts that dominate gill filaments, the AOP-cells inside these vacuoles appear to be coccoid. The AOP-containing vacuoles were never observed in symbiont-free cells near the dorsal ends of the filaments where they attach to the snail’s mantle (not shown). This contrasts sharply with the exclusive infection of “Ca. E. bathymodiolii” in the nuclei of symbiont-free intercalary cells in the gills of their mussel hosts (Zielinski et al., 2009).

!

81

We also used TEM to examine the structure and morphology of the bacteria inhabiting Alviniconcha gill tissue, revealing membrane-bound vacuoles likely containing AOP. Inspection of the gill tissue of a γ-proteobacteria-hosting individual showed that gram-negative, filamentous and rod-shaped bacterial symbionts were densely packed at the apical ends of the cells (Fig.5.3a), consistent with previous descriptions of Alviniconcha gill morphology (Endow and Ohta, 1989; Stein et al., 1988; Urakawa et al., 2005). Our examination clearly showed that these canonical symbionts consist of two morphotypes (Fig.5.3b,c,d), which are either free in the host cytoplasm or contained within individual vacuoles (challenges with preservation makes it difficult to distinguish their precise position). These two distinct morphologies very likely represent the two γ-proteobacterial symbiont phylotypes, though they could also reflect morphological variation within a single symbiont phylotype. As we observed via FISH, we found vacuoles containing a third bacterial morphotype–likely the AOP
0.5

phylotype- distributed sporadically throughout the gill tissue (Fig.5.4). These membrane-bound compartments are full of small (~1 μm), coccoid,

0.5

gram-negative

bacterial

cells

that

contain

electron-dense particles, that are somewhat similar to those observed in “Ca. E.

bathymodiolii” via TEM (Zielinski et al., 2009).
2

Figure 5.4: A transmission electron micrograph of a suspected AOP vacuole inside a bacteriocyte of a γ-proteobacteria-hosting Alviniconcha. Inset shows a single cell inside the suspected AOP vacuole. All scale bars are shown in μm.

!

82

Distribution and abundance of AOP in ELSC Alviniconcha Because our microscopic examination of AOP in gill tissue suggested specificity for Alviniconcha types hosting γ-proteobacteria, we used quantitative PCR (qPCR) to examine the distribution and abundance of AOP in 283 Alviniconcha from across four vent fields at the ELSC (Supporting Methods). We had previously genotyped these Alviniconcha host individuals by sequencing their mitochondrial cytochrome-c oxidase gene and quantified the proportions of the three chemoautotrophic symbiont phylotypes in each using qPCR of their 16S rRNA genes (Beinart et al., 2012). This survey demonstrated that there are three genetically distinct Alviniconcha host types (likely undescribed species), which form specific associations with three proteobacterial phylotypes. Host types I and III mainly associate with two γ-proteobacterial phylotypes (γ-1, γ-Lau) and host type II primarily associates with an ε-proteobacterial phylotype (Beinart et al., 2012). Among the three host types, each individual snail is typically dominated by either γ- or ε-proteobacterial symbionts, with only one of the three phylotypes representing >99% of the detected symbiont 16S rRNA genes in a single individual. Minor, co-occurring populations of one of the other phylotypes are sometimes detected, and a small number of γproteobacteria-hosting individuals associate with equal proportions of the two γ-proteobacterial phylotypes. Using qPCR primers targeting AOP’s 16S rRNA gene (Supporting Methods), we determined the proportion of AOP relative to the canonical symbiont populations within each snail, as well as their prevalence according to host type (Tables S5.1, S5.2). AOP was detected in 63% of the surveyed Alviniconcha individuals but consistently represented only a minor proportion of the total detected bacterial 16S rRNA genes (0-36%, median 0.53%) (Table S5.1, S5.2). As seen with FISH, the prevalence of AOP differed between Alviniconcha dominated by ε- and γproteobacterial symbionts. In Alviniconcha hosting primarily γ-proteobacteria of either or both !
83

phylotypes (host type I and III), AOP was detected in the large majority (96%) of individuals. In contrast, AOP was detected in only 5 of the 102 Alviniconcha individuals hosting primarily εproteobacteria (mainly host type II, a few host type I). Along with a greater frequency, we also found a greater relative abundance of AOP 16S rRNA genes in Alviniconcha that host γ-proteobacteria (Mann-Whitney U p<0.0001, SPSS v20). Similarly, our search of 16S rRNA gene pyrosequences from Alviniconcha hosting γor ε-

proteobacteria (Sanders et al, 2013) revealed that sequences allied to AOP were only detected in Alviniconcha that host γ-proteobacteria (0.3 and 2% of the sequence reads). No sequences classified as Oceanospirillales were detected in the Alviniconcha hosting ε-proteobacteria. Additionally, when we compared the proportion of AOP 16S rRNA genes among Alviniconcha dominated by each symbiont phylotype, excluding the 8 individuals with approximately equal proportions of the two γ-proteobacterial phylotypes, we also observed a significant difference (data not shown; Kruskal-Wallis p<0.0001, SPSS v20). Individuals dominated by either the γ-1 or the γ-Lau phylotypes had significantly greater proportions of AOP than individuals dominated by the εproteobacterial symbiont (Post-hoc Mann-Whitney U p<0.0001 for both, Bonferroni corrected α=0.0167, SPSS v20) but were not significantly different than one another (Mann-Whitney U p=0.027, Bonferroni corrected α=0.0167, SPSS v20). Even within the single host type (III) that can be dominated by either of the γ-proteobacterial phylotypes, we found no significant difference in AOP proportion between individuals dominated by the γ-1 or γ-Lau (MannWhitney U p=0.352, SPSS v20). These patterns demonstrated that AOP predominantly associated with Alviniconcha hosting γ-proteobacteria and was only rarely detected in Alviniconcha hosting ε-proteobacteria. This specificity was relatively consistent throughout Alviniconcha from the four ELSC vent fields (Table S5.3), despite the fact that γ- and ε-proteobacteria hosting Alviniconcha are conversely !
84

dominant at geographically distant vent fields separated by 10s to 100s of kilometers (Beinart et al., 2012). For example, of the 10 ε-proteobacteria hosting individuals from ABE, a vent field that is inhabited by mostly γ-proteobacteria hosting Alviniconcha with typical levels of AOP, only one had detectable AOP. Thus, even at a vent field where most of their neighbors are hosting AOP, Alviniconcha hosting ε-proteobacteria still have an apparent low frequency of association. This indicates that geography is not structuring the frequency of AOP in the ELSC Alviniconcha population, but rather that biological determinants are more important. Overall, the observed pattern of correspondence with the γ-proteobacterial symbionts implies that AOP interacts with these particular symbionts and/or has specificity for the two host types that associate with them. It is difficult to resolve these two options, since host and symbiont identity are linked. However, to address this issue, we compared the abundance of AOP among individuals of host type I, which can either associate with γ-proteobacterial or ε-proteobacterial symbionts, and found that there was no significant difference between individuals hosting the different symbiont classes (Mann-Whitney U p=0.092, SPSS v20). This must be interpreted with caution, however, since there is a large difference in sample size between host type I individuals hosting ε-proteobacteria (n=6) and those hosting γ-proteobacteria (n=93). With that caveat, it appears that host type may be more important than symbiont class in determining infection by the AOP.

Potential Modes of Interaction between AOP and Alviniconcha Here we present two possibilities that represent ends of the spectrum of animal-bacterial associations, from parasitic to beneficial, and consider the degree to which these data are consistent with both scenarios. In terms of parasitism, AOP is closely related to the intranuclear parasites of hydrothermal vent mussels (95% 16S rRNA gene identity). However, we never !
85

definitively observed AO in host nuclei. Even if it is not nuclear-specific, it is possible that AOP represents a parasite or pathogen of Alviniconcha that is contained inside a membrane-bound vacuole, as is common with other intracellular pathogens (Goebel and Gross, 2001; Casadevall, 2008; Kumar and Valdivia, 2009). Alternatively, AOP may be mutualistically associated with Alvinivoncha. AOP appears to be lower in abundance than the canonical symbionts. As such, AOP may represent a minor, secondary symbiont of Alviniconcha that provides beneficial function directly (e.g., the breakdown of an organic compound) or indirectly (e.g., by facilitating the metabolism of the other symbionts). Among insects, secondary symbionts, although an order of magnitude lower in abundance than the primary symbionts, can confer ecologically important advantages for their hosts (Mira and Moran, 2002; Oliver et al., 2010). It is worth noting that AOP is most closely related to Endozoicomonas-like phylotypes found in association with tropical, shallow-water corals (Bourne and Munn, 2005; Sunagawa et al., 2010). Recent efforts have led to the cultivation of Endozoicomonas-like isolates from corals, and have shown that they can degrade dimethylsulfoniopropionate (DMSP) (Raina et al., 2009) that is produced by the algal symbionts of corals (Van Alstyne et al., 2008). This suggests that Endozoicomonas play an important role in sulfur cycling within or around the host corals. Though DMSP production is thought to be specific to marine algae, AOP could similarly play a role in sulfur cycling in Alviniconcha.

Conclusions The discovery of symbioses between chemoautotrophic bacteria and invertebrates led to a watershed of research on these types of associations from many habitats, with much of the focus on the canonical, chemoautotrophic symbionts (Dubilier et al., 2008; Cavanaugh et al., 2006). Throughout 40 years of research, there has been little evidence for the presence of minor microbial associates (i.e., microbes that form specific associations with their hosts but are present !
86

in low abundance, including non-chemoautotrophs). Here, through a combination of phylogenetics, microscopy and qPCR surveys, we have established that AOP are minor, but specific and frequent, associates of Alviniconcha. While the precise nature of the interaction remains to be determined, the data presented herein further extends the diversity –and potentially the functional role- of intracellular bacteria associated with Alviniconcha. This is the first description of an Oceanospirillales associating with Alviniconcha or any other hydrothermal vent gastropod and the second description of an Oceanospirillales associating with a symbiotic, hydrothermal vent mollusc. With growing awareness of the significance of microbes, either as parasites or mutualists, to organismal health and function, investigations of minor microbial associates across the known diversity of invertebrate-chemoautotrophic symbioses are warranted.

Experimental Procedures Alviniconcha collections: Animals were recovered with the remotely operated vehicle JASON II during expedition TM-235 in 2009 on-board the RV Thomas G. Thompson. Upon recovery, Alviniconcha snails were placed into ice-cold seawater and kept at 4 °C prior to sampling. Gill tissue was excised and preserved for molecular and microscopic analysis of the bacterial populations associated with Alviniconcha. See (Beinart et al., 2012) for details of Alviniconcha collected for 16S rRNA gene sequencing and the quantitative PCR survey. In addition to these specimens, the gills of six other Alviniconcha were fixed for microscopy. The ε-proteobacterial-hosting individuals were collected from the vent field Tow Cam (Dive 432) on June 7, 2009. The γ-proteobacterial-hosting individuals were collected from the vent field ABE (Dive J2-435) on June 14, 2009.

Phylogenetic Analysis !
87

16S rRNA gene sequences were recovered from the pooled DNA of 30 Alviniconcha individuals from two vent fields (as described in Beinart et al., 2012). Briefly, the 16S rRNA gene was amplified using the universal bacterial primers 27F and 1492R, cloned with the TOPO TA cloning kit (Invitrogen Inc., Carlsbad, CA USA) and sequenced unidirectionally. BLASTN (Altschul et al., 1990) of all recovered sequences revealed that two of the clones held novel 16S rRNA gene sequences from the Order Oceanospirillales. One clone from this pair was bidirectionally sequenced and deposited in Genbank with accession number JX198551 and the other partial sequence with accession number JX206825. An alignment of 16S rRNA gene sequences was created with the NAST Alignment tool in GreenGenes (DeSantis, Hugenholtz et al. 2006), trimmed to the shortest sequence (1264 positions) with Geneious (Drummond AJ, Ashton B et al. 2011), then used to produce a Bayesian inference phylogeny with MrBayes (Altekar, Dwarkadas et al. 2004) implementing the GTR+I+G model of substitution. Three replicate runs of 107 generations each were performed with sampling every 103 generations and burn-in of 2500 samples. Quantitative and qualitative diagnostics were performed for each of the three runs using the Coda package in R (Plummer, Best et al. 2006), the three replicate runs were combined and a 50% majority rule consensus tree was created in MrBayes.

Fluorescence in situ hybridization An oligonucleotide FISH probe (AOP 5'CCGTACTCCAGCCACCCA) targeting the AOP 16S rRNA gene sequences was created by modifying the FISH probe Bnix643 that was previously designed to target the closely related Oceanospirillales found to infect the vent mussels of the genus Bathymodiolus (Zielinski et al., 2009). Specific hybridization conditions for the AOP probe were found by varying the concentration of formamide in the hybridization buffer.

!

88

Dual FISH hybridizations were performed using a Cy3-labeled, AOP-specific probe (5'CCGTACTCCAGCCACCCA) and Cy5-labeled, universal bacterial EUB338(I-III) probes (Amann et al., 1990). Subsamples of Alviniconcha gill tissues were fixed for 12-24 hours at 4°C in 1X phosphate buffered saline (PBS: 137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 2 mM KH2PO4) containing 2% paraformaldehyde. Gill samples were subsequently washed three times in 1X PBS, transferred to storage solution of equal parts 1X PBS and ethanol and kept at 4°C until embedding. Gill samples were dehydrated in an ascending ethanol series, washed twice in xylene, then embedded in paraffin. Paraffin blocks were sectioned with a microtome into 5 μm thick sections. The sections were placed onto Super-Frost slides (Fisher Scientific, Waltham, MA USA), dewaxed in three successive baths of xylene for 10 min each and a descending ethanol series (96%, 80%, 70%, 50%) for 5 min each and finally air dried. Each section was circled with a wax pen (PAP-pen, Kisker Biotech, Steinfurt, Germany), then covered with 30% formamide hybridization buffer (Pernthaler et al., 2002) containing fluorescently labeled oligonucleotide probes (5 ng μl-1 final concentration). Hybridization, washing, DAPI staining and mounting of sections on slides was performed as in (Jillian et al., 2010). Negative controls to account for background autofluorescence were performed with NON338 (Wallner et al., 1993). Sections were examined and photographed using the fluorescence microscope Axioskop2 mot plus (Carl Zeiss, Inc., Göttingen, Germany). The ImageJ software plugin DeconvolutionLab (Vonesch and Unser, 2008) was used for deconvolution of the images, and ImageJ used for contrast adjustment, and assignment of colors to the different wavelengths.

Transmission Electron Microscopy Subsamples of the paraformaldehyde fixed gills (see FISH preservation) were post-fixed in a solution of 1% osmium tetroxide and 0.8% potassium ferricyanide in 0.1M sodium cacodylate !
89

with 0.375M NaCl for 1.5 hr at 4°C, then washed in distilled water, dehydrated through an ascending ethanol series, cleared in 100% acetone, and embedded in an epoxy mixture of Embed 812 (Electron Microscopy Sciences, Hatfield, PA USA) and Araldite 506 (Ernest Fulham Inc., Albany, NY USA). Thin sections (80 nm) were obtained using a diamond knife on a LKB Ultramicrotome V followed by staining with 2% uranyl acetate and Reynold’s lead citrate, and viewed with a FEI Tecnai Biotwin G2 Spirit electron microscope (Hillsboro, OR USA) operated at 80 kV. The contrast of the micrographs was adjusted in Adobe Photoshop Elements.

Quantitative PCR Survey A SYBR-green quantitative PCR (qPCR) assay was designed to target the AOP 16S rRNA genes. QPCR was performed with the and primers AOP-R AOP-F (5' (5'

TTTCCAGAGATGGATGGGTGCCTT)

ACCCAAAGTGCTGGTAACTGAGGA) at a final concentration of 300 μM. The proportion of AOP was estimated in each individual Alviniconcha as in (Beinart et al., 2012) using a standard curve made of 10 to 107 copies of linearized plasmid containing the 16S rRNA AOP representative sequence. Via tests against plasmid-based standard curves containing the 16S rRNA genes of the other Alviniconcha symbiont phylotypes, the AOP-specific qPCR assay was found to cause slight non-specific amplification with the 16S rRNA gene of the Alviniconcha symbiont γ-Lau. The maximum number of γ-Lau 16S rRNA gene copies, in any given sample, was on the order of 106, which we found would result in non-specific amplification equal to that of 10 copies of AOP. Therefore, to ensure that the number of AOP 16S rRNA gene copies was not overestimated due to this non-specific amplification, 10 copies were subtracted from the AOP counts for all samples. Additionally, all quantities were also adjusted for amplification inhibition as in (Beinart et al., 2012). !
90

Acknowledgements This material is based upon work supported by the National Science Foundation (GRF grant no. DGE-1144152 to RAB, IOS-0958006 to SVN, and OCE-0732369 to PRG). SVN was also supported by the University of Connecticut Research Foundation. ND is grateful for funding from the Max Planck Society and the DFG Cluster of Excellence ‘The Ocean in the Earth System’ at MARUM, Bremen. We would like to thank the crews of the RV Thomas G. Thompson and the ROV JASON II for their support. We thank the Histology Core at the Beth Israel Deaconess Medical Center for embedding the tissue for FISH microscopy, and S. Wetzel of the Max Planck Institute for Marine Microbiology for assistance with FISH sample processing and imaging. Additionally, we are grateful to S. Daniels of the University of Connecticut Electron Microscopy facility for preparation and transmission electron microscopy imaging. We also thank D. Richardson of the Harvard Center for Biological Imaging for assistance with image deconvolution. We also thank A. Knoll, C. Cavanaugh and C. Marx for their comments that improved the quality of this manuscript.

References Altschul,S.F. et al. (1990) Basic local alignment search tool. Journal of Molecular Biology 215: 403– 410. Amann,R.I. et al. (1990) Combination of 16S rRNA-targeted oligonucleotide probes with flow cytometry for analyzing mixed microbial populations. Appl. Environ. Microbiol. 56: 1919–1925. Bayer,T., Arif,C., et al. (2013) Bacteria of the genus Endozoicomonas dominate the microbiome of the Mediterranean gorgonian coral Eunicella cavolini. Mar. Ecol. Prog. Ser. 479: 75–84. Bayer,T., Neave,M.J., et al. (2013) The microbiome of the Red Sea coral Stylophora pistillata is dominated by tissue-associated Endozoicomonas bacteria. Appl. Environ. Microbiol. Beinart,R.A. et al. (2012) Evidence for the role of endosymbionts in regional-scale habitat partitioning by hydrothermal vent symbioses. Proceedings of the National Academy of Sciences. Bourne,D.G. and Munn,C.B. (2005) Diversity of bacteria associated with the coral Pocillopora damicornis from the Great Barrier Reef. Environ. Microbiol. 7: 1162–1174. Bourne,D.G. et al. (2013) Coral reef invertebrate microbiomes correlate with the presence of photosymbionts. 1–7. !
91

Casadevall,A. (2008) Evolution of Intracellular Pathogens. Annu. Rev. Microbiol. 62: 19–33. Cavanaugh,C. et al. (2006) Marine Chemosynthetic Symbioses. In, The Prokaryotes. pp. 475–507. Chen,M.H. et al. (2013) Corallomonas stylophorae gen. nov., sp. nov., a halophilic bacterium isolated from the reef-building coral Stylophora pistillata. International Journal of Systematic and Evolutionary Microbiology 63: 982–988. Costa,P.M. et al. (2012) Molecular detection of prokaryote and protozoan parasites in the commercial bivalve Ruditapes decussatus from southern Portugal. Aquaculture 370-371: 61– 67. Desbruyeres,D. et al. (1994) Deep-sea hydrothermal communities in southwestern Pacific backarc basins (The North Fiji and Lau Basins) - composition, microdistribution and food-web. Marine Geology 116: 227–242. Dubilier,N. et al. (2008) Symbiotic diversity in marine animals: the art of harnessing chemosynthesis. Nat Rev Micro 6: 725–740. Endow,K. and Ohta,S. (1989) The symbiotic relationship between bacteria and a mesogastropod snail, Alviniconcha hessleri, collected from hydrothermal vents of the Mariana back-arc basin. Bulletin of the Japanese Society of Microbial Ecology 3: 73–82. Flemer,B. et al. (2011) Diversity and antimicrobial activities of microbes from two Irish marine sponges, Suberites carnosus and Leucosolenia sp. Journal of Applied Microbiology 112: 289–301. Garrity,G.M. et al. (2005) Oceanospirillales ord. nov. In, Brenner,D.J. et al. (eds), Bergey’s Manual® of Systematic Bacteriology. Springer, New York, pp. 270–323. Goebel,W. and Gross,R. (2001) Intracellular survival strategies of mutualistic and parasitic prokaryotes. Trends in Microbiology 9: 267–273. Goffredi,S.K. et al. (2005) Evolutionary innovation: a bone-eating marine symbiosis. Environ. Microbiol. 7: 1369–1378. Henry,M.S. et al. (2008) Metabolic rates and thermal tolerances of chemoautotrophic symbioses from Lau Basin hydrothermal vents and their implications for species distributions. Deep Sea Research Part I: Oceanographic Research Papers 55: 679–695. Jensen,S. et al. (2010) Intracellular Oceanospirillales bacteria inhabit gills of Acesta bivalves. FEMS Microbiology Ecology 74: 523–533. Jillian,M.P. et al. (2010) Dual symbiosis of the vent shrimp Rimicaris exoculata with filamentous gamma‐and epsilonproteobacteria at four Mid‐Atlantic Ridge hydrothermal vent fields. Environ. Microbiol. 9999:. Johnson,S.B. et al. (2010) Rubyspira, New Genus and Two New Species of Bone-Eating DeepSea Snails With Ancient Habits. The Biological Bulletin 219: 166–177. Kennedy,J. et al. (2008) Diversity of microbes associated with the marine sponge, Haliclona simulans, isolated from Irish waters and identification of polyketide synthase genes from the sponge metagenome. Environ. Microbiol. 10: 1888–1902. Kumar,Y. and Valdivia,R.H. (2009) Leading a Sheltered Life: Intracellular Pathogens and Maintenance of Vacuolar Compartments. Cell Host and Microbe 5: 593–601. Kurahashi,M. and Yokota,A. (2007) Endozoicomonas elysicola gen. nov., sp. nov., a γproteobacterium isolated from the sea slug Elysia ornata. Systematic and Applied Microbiology 30: 202–206. La Rivière,M. et al. (2013) Transient Shifts in Bacterial Communities Associated with the Temperate Gorgonian Paramuricea clavata in the Northwestern Mediterranean Sea. PLoS ONE 8: e57385. Mira,A. and Moran,N.A. (2002) Estimating Population Size and Transmission Bottlenecks in Maternally Transmitted Endosymbiotic Bacteria. Microb Ecol 44: 137–143. !
92

Nishijima,M. et al. (2013) Endozoicomonas numazuensis sp. nov., a gammaproteobacterium isolated from marine sponges, and emended description of the genus Endozoicomonas Kurahashi and Yokota 2007. International Journal of Systematic and Evolutionary Microbiology 63: 709–714. Oliver,K.M. et al. (2010) Facultative Symbionts in Aphids and the Horizontal Transfer of Ecologically Important Traits. Annu. Rev. Entomol. 55: 247–266. Pernthaler,A. et al. (2002) Fluorescence In Situ Hybridization and Catalyzed Reporter Deposition for the Identification of Marine Bacteria. Appl. Environ. Microbiol. 68: 3094–3101. Podowski,E.L. et al. (2010) Biotic and abiotic factors affecting distributions of megafauna in diffuse flow on andesite and basalt along the Eastern Lau Spreading Center, Tonga. Mar. Ecol. Prog. Ser. 418: 25–45. Podowski,E.L. et al. (2009) Distribution of diffuse flow megafauna in two sites on the Eastern Lau Spreading Center, Tonga. Deep-Sea Research Part I 56: 2041–2056. Raina,J.B. et al. (2009) Coral-Associated Bacteria and Their Role in the Biogeochemical Cycling of Sulfur. Appl. Environ. Microbiol. 75: 3492–3501. Ramirez-Llodra,E. et al. (2007) Biodiversity and Biogeography of Hydrothermal Vent Species Thirty Years of Discovery and Investigations. Oceanography 20: 30–41. Sanders,J.G. et al. (2013) Metatranscriptomics reveal differences in in situ energy and nitrogen metabolism among hydrothermal vent snail symbionts. ISME J 1–12. Stein,J.L. et al. (1988) Chemoautotrophic symbiosis in a hydrothermal vent gastropod. Biol. Bull. 174: 373–378. Sunagawa,S. et al. (2010) Threatened corals provide underexplored microbial habitats. PLoS ONE 5: e9554. Suzuki,Y. et al. (2006) Host-symbiont relationships in hydrothermal vent gastropods of the genus Alviniconcha from the Southwest Pacific. Appl. Environ. Microbiol. 72: 1388–1393. Suzuki,Y., Sasaki,T., Suzuki,M., Nogi,Y., et al. (2005) Novel chemoautotrophic endosymbiosis between a member of the Epsilonproteobacteria and the hydrothermal-vent gastropod Alviniconcha aff. hessleri (Gastropoda : Provannidae) from the Indian Ocean. Appl. Environ. Microbiol. 71: 5440–5450. Suzuki,Y., Sasaki,T., Suzuki,M., Tsuchida,S., et al. (2005) Molecular phylogenetic and isotopic evidence of two lineages of chemo auto trophic endosymbionts distinct at the subdivision level harbored in one host-animal type: The genus Alviniconcha (Gastropoda : Provannidae). FEMS Microbiology Letters 249: 105–112. Urakawa,H. et al. (2005) Hydrothermal vent gastropods from the same family (Provannidae) harbour epsilon- and gamma-proteobacterial endosymbionts. Environ. Microbiol. 7: 750–754. Van Alstyne,K.L. et al. (2008) Is dimethylsulfoniopropionate (DMSP) produced by the symbionts or the host in an anemone–zooxanthella symbiosis? Coral Reefs 28: 167–176. Van Dover,C.L. et al. (2001) Biogeography and ecological setting of Indian Ocean hydrothermal vents. Science 294: 818–823. Verna,C. et al. (2010) High symbiont diversity in the bone-eating worm Osedax mucofloris from shallow whale-falls in the North Atlantic. Environ. Microbiol. 12: 2355–2370. Vonesch,C. and Unser,M. (2008) A fast thresholded Landweber algorithm for waveletregularized multidimensional deconvolution. Image Processing. Wallner,G. et al. (1993) Optimizing fluorescent in situ hybridization with rRNA-targeted oligonucleotide probes for flow cytometric identification of microorganisms. Cytometry 14: 136–143. Yang,C.S. et al. (2010) Endozoicomonas montiporae sp. nov., isolated from the encrusting pore !
93

coral Montipora aequituberculata. International Journal of Systematic and Evolutionary Microbiology 60: 1158–1162. Zielinski,F.U. et al. (2009) Widespread occurrence of an intranuclear bacterial parasite in vent and seep bathymodiolin mussels. Environ. Microbiol. 11: 1150–1167. Zurel,D. et al. (2011) Composition and dynamics of the gill microbiota of an invasive IndoPacific oyster in the eastern Mediterranean Sea. Environ. Microbiol. 13: 1467–1476.

!

!

94

! ! !

Appendix 1 Chapter 1 Supplemental Material

Supporting Information
Beinart et al. 10.1073/pnas.1202690109
SI Methods used for sampling vent effluent are precharged with a small amount of seawater to fill the dead volume, and varying amounts of ambient seawater may be entrained inadvertently during sampling. The proportions of seawater and vent end-member fluid in the samples were determined via the concentrations of dissolved magnesium ions (Mg2+), because seawater contains abundant Mg2+, whereas end-member hydrothermal fluids exiting the vent orifice typically contain nearly zero Mg2+ concentrations (1). End-member ventfluid composition then is calculated by assuming conservative mixing and extrapolating the measured concentration of a given species to a zero-Mg2+ value using a least squares linear regression forced through seawater composition.
PCR Amplification, Sequencing, and Phylogenetic Analyses of the Host Mitochondrial Cytochrome Oxidase 1 Genes. The cytochrome oxiVent Fluid End-Member Calculations. The isobaric gastight samplers

dase 1 (CO1) mitochondrial gene was amplified using universal invertebrate primers LCO1490 and HCO2198 (2) in association with the TW2 and Gastro 3 primers (3). PCRs were performed with EconoTaq DNA Polymerase (Lucigen, Inc.), with 5 min at 95 °C, 40 cycles of 40 s at 94°c, 60 s at 50 °C, 90 s at 72 °C, followed by 5 min at 72 °C. PCR products were run on a 1% (wt/vol) agarose gel stained with ethidium bromide to check the quantity and the quality of the products and then were purified with ExoSAP-IT (Affymetrix, Inc.). Purified PCR products for the mitochondrial gene CO1 were sequenced bidirectionally with BigDye chemistry (version 3.1) (Applied Biosystems, Inc.) on an ABI 3730xl capillary sequencer (Applied Biosystems, Inc.). Quality of the sequence reads and alignment of the sequences were assessed with Chromas 2.22 (Technelysium Pty. Ltd.) and Geneious Pro-5 (4). Sequences were aligned with MUSCLE (5) in Mesquite v2.75 (6) and trimmed to 192 characters, the length for which all samples had unambiguous sequence. Bayesian inference phylogenies were produced with BEAST (7) using the SRD06 model of nucleotide evolution (8), which partitions protein coding sequence into first plus second and third codon positions, estimating parameters for each. Three replicate runs of 50 million generations were performed with sampling every 1,000 generations, thinning to every 3,000 generations with a burn-in of 3,000 samples. Quantitative and qualitative diagnostics were performed for each of the three runs using the Coda package in R (9), the three replicate runs were combined using LogCombiner, and a tree was created with TreeAnnotator (7). Host CO1 gene sequences used for phylogenetics were deposited in GenBank; accession numbers can be found in Table S1.

vitrogen, Inc.). Partial sequences from each collection were obtained by sequencing unidirectionally. The resulting 16S rRNA gene sequences were trimmed of vector using Sequencher 4.10 (Gene Codes, Inc.) and classified into phylotypes based on their affiliation, via BLAST (11), with known Alviniconcha symbiont phylotypes. Partial sequences were deposited in GenBank under accession nos. JX206808–JX206824, JX206826, and JX206827. Representative longer sequences were aligned with other symbiont and free-living Proteobacterial sequences using the NAST Alignment tool in GreenGenes (12). Bayesian inference phylogenies using separate 1,240-position alignments of the γ- and ε-proteobacteria (with β- and δ-proteobacterial sequences as the outgroups, respectively) were produced with BEAST (7) implementing the GTR+I+G model of substitution. For the ε-proteobacterial tree, three replicate runs of 10 million generations each were performed with sampling every 1,000 generations and burn-in of 3,000 samples. For the γ-proteobacterial tree, three replicate runs of 50 million generations each were performed with sampling every 1,000 generations, thinning to every 5,000 generations (to reduce autocorrelation), and a burnin of 3,000 samples. Quantitative and qualitative diagnostics were performed for each of the three runs using the Coda package in R (9), the three replicate runs were combined using LogCombiner, and a tree was created with TreeAnnotator (7).
Design and Optimization of Quantitative PCR Assays Targeting the Symbiont 16S rRNA Genes. Primers were designed and initially

30 individual snails from three collections: ABE-1, KM-1, and KM-2. PCR reactions were performed with High Fidelity Platinum Taq polymerase (Invitrogen, Inc.), using universal bacterial 27F and 1492R primers (10), 2 mM MgSO4 for 2 min at 95 °C, 30 cycles of 30 s at 95 °C, 30 s at 55 °C, 90 s at 72 °C, followed by 5 min at 72 °C. PCR products were subjected to electrophoresis on a 1.2% (wt/vol) agarose gel stained with SYBR Safe (Invitrogen, Inc.) to check the quantity and the quality of the products using a U:Genius UV transilluminator (Syngene, Inc.). Then 5 μL of product from each reaction were combined in separate pools for each collection. Pooled PCR products were cleaned and concentrated with the QIAQuick PCR Purification kit (Qiagen, Inc.) and then were cloned with the TOPO TA Cloning kit (InBeinart et al. www.pnas.org/cgi/content/short/1202690109

PCR Amplification, Sequencing, and Phylogenetic Analyses of the Symbiont 16S rRNA Genes. 16S rRNA genes were amplified from

checked for specificity to Alviniconcha symbiont phylotypes by comparison with all available 16S rRNA gene sequences with Primer-BLAST (13). All assays were performed on a Stratagene MX3005p sequence detector (Stratagene, Inc.) in 96-well optical-grade plates and seals. Each assay was optimized using standard curves created from linearized plasmids (pCR2.1; Invitrogen) with the 16S rRNA gene from each symbiont type inserted (same clones as used in phylogenetic analysis). These standard curves spanned seven orders of magnitude and were designed to allow the addition of 101–107 gene copies as 2 μL of template in each PCR. Twenty-microliter reactions were used, with a final concentration of 1× Perfecta SYBR Green FastMix, low ROX (Quanta BioSciences, Inc.), and varying concentrations of primers (Table S2). PCR cycling conditions were 3 min at 95 °C, then 40 cycles of 30 s at 95 °C, 1 min at 65 °C, and 30 s at 72 °C. Data analyses were carried out with the system software MXPro (Stratagene Inc.). The potential cross-reactivity of each assay for nontarget symbiont sequences was evaluated by comparing the amplification of nontarget controls (plasmids containing nontarget 16S sequences at 107 and 106 plasmid copies per reaction) with a standard curve (plasmids containing the target 16S sequence) for each quantitative PCR (qPCR) assay. No cross-reactivity was found among any combination of qPCR assay and nontarget plasmids.

amplification of the diluted Alviniconcha DNA samples, γ-1 qPCR reactions with each diluted DNA sample were spiked with 104 copies of target sequence (plasmids containing the target γ-1 16S rRNA gene). An increase in the cycle threshold (Ct) of the positive control caused by inhibition by the diluted DNA extract was detected by comparison with the Ct of the positive control alone. The PCR efficiency was calculated as in ref. 14. The average efficiency for all samples was 98.8% ± 0.07%.
1 of 5

Assessment of and Accounting for Amplification Inhibition in qPCR Reactions. To assess potential influences of PCR inhibition on the

! !
96

!

Assessing Symbiont Genome Equivalents with 16S rDNA qPCR. The interpretation of qPCR targeting the 16S rRNA gene can be complicated by the fact that bacterial genomes can contain multiple copies of this gene. Both ε- and γ-proteobacteria have multiple 16S rRNA genes (2.58 copies and 5.81 copies, respectively) (15). However, these averages are likely overestimates for the symbionts of Alviniconcha, because the genomes of all chemosynthetic endosymbionts sequenced to date of have been found to contain a single copy of this gene (16–18). Additionally, the differences in the number of detected 16S rRNA genes in the different symbiont phylotypes within a single individual typically were found to be at least one order of magnitude. Therefore, any differences in 16S rRNA gene copy
1. Von Damm KL (1995) Controls on the chemistry and temporal variability of seafloor hydrothermal fluids. Seafloor Hydrothermal Systems: Physical, Chemical, Biological, and Geological Interactions, Geophys Monogr Ser (American Geophysical Union, Washington, DC), 91:222–247. 2. Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R (1994) DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol Mar Biol Biotechnol 3(5):294–299. 3. Kojima S, et al. (2001) Phylogeny of hydrothermal-vent-endemic gastropods Alviniconcha spp. from the western Pacific revealed by mitochondrial DNA sequences. Biol Bull 200(3):298–304. 4. Drummond AJ, et al. (2010) Geneious Pro v5.1. Available at www.geneious.com. Accessed February 2012. 5. Edgar RC (2004) MUSCLE: Multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res 32(5):1792–1797. 6. Maddison WP, Maddison DR (2011) Mesquite: A modular system for evolutionary analysis. Version 2.75. Available at http://mesquiteproject.org. 7. Drummond AJ, Rambaut A (2007) BEAST: Bayesian evolutionary analysis by sampling trees. BMC Evol Biol 7(1):214. 8. Shapiro B, Rambaut A, Drummond AJ (2006) Choosing appropriate substitution models for the phylogenetic analysis of protein-coding sequences. Mol Biol Evol 23(1):7–9. 9. Plummer M, Best N, Cowles K, Vines K (2006) CODA: Convergence diagnosis and output analysis for MCMC. R News 6(1):7–11. 10. Lane DJ (1991) 16S/23S rRNA sequencing. Nucleic Acid Techniques in Bacterial Systematics, eds Stackebrandt E, Goodfellow M (Wiley and Sons, New York), pp 115–175.

number (if they exist) are not likely to alter the trends found here significantly. with the software package PRIMER-E (v6) (19). Analysis of similarity tests yield a test statistic, R, that can range from −1 to 1. A value of zero indicates the null hypothesis: that there is equal dissimilarity within and between groups. A value greater than 0 indicates that there is greater dissimilarity among groups than within them, and an R value less than 0 indicates greater dissimilarity within groups than between them. Values of R, if significant, can be compared, because R values are an absolute measure of dissimilarity between groups.
11. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990) Basic local alignment search tool. J Mol Biol 215(3):403–410. 12. DeSantis TZ, Jr., et al. (2006) NAST: A multiple sequence alignment server for comparative analysis of 16S rRNA genes. Nucleic Acids Res 34(Web Server issue):suppl 2):W394-9. 13. Rozen S, Skaletsky H (1999) Primer3 on the WWW for General Users and for Biologist Programmers. Bioinformatics Methods and Protocols, Methods in Molecular Biology, eds Misener S, Krawetz SA (Humana, Totowa, NJ), Vol 132, pp 365–386. 14. Short SM, Zehr JP (2005) Quantitative analysis of nifH genes and transcripts from aquatic environments. Methods in Enzymology, ed Jared RL (Academic Press, San Diego) Vol 397, pp 380–394. 15. Lee ZM-P, Bussema C III, Schmidt TM (2009) rrnDB: Documenting the number of rRNA and tRNA genes in bacteria and archaea. Nucleic Acids Res 37(Database issue):suppl 1):D489–D493. 16. Robidart JC, et al. (2008) Metabolic versatility of the Riftia pachyptila endosymbiont revealed through metagenomics. Environ Microbiol 10(3):727–737. 17. Woyke T, et al. (2006) Symbiosis insights through metagenomic analysis of a microbial consortium. Nature 443(7114):950–955. 18. Newton ILG, et al. (2007) The Calyptogena magnifica chemoautotrophic symbiont genome. Science 315(5814):998–1000. 19. Clarke KR, Gorley RN (2006) Primer v6: User Manual/Tutorial (PRIMER-E, Plymouth, United Kingdom).

Analysis of Similarity. All multivariate statistics were performed

Beinart et al. www.pnas.org/cgi/content/short/1202690109

2 of 5

! !
97

!

!
Dive 19 May 6 June 88.2 (92.2) 50.5 (118) 20 May 5 June 6 June 2.5 (2.5) 2.5 (2.5) TC-1 TC-2 TC-3 KM-1 KM-2 20 3.18′ S, 176 8.02′ W 20 3.23′ S, 176 8.01′ W Chimney wall Chimney wall 6.9 (6.9) Dive date Alv Collection (2009) (n) ID Habitat Latitude and longitude Cyclic Oxygen, μM Oxygen, μM Temperature, °C Temperature, °C Sulfide, μM Sulfide, μM voltammetry average minimum average minimum average minimum scan sets (n) (median) (maximum) (median) (maximum) (median) (maximum) 4.8 (9.9) 54.4 (43.4) 29.8 (126) 20 19.00′ S, 176 8. 19′ W Chimney wall 20 18.97′ S, 176 8.19′ W Chimney wall 20 18.98′ S, 176 8.19′ W Diffuse flow 15.6 (15.6) 14.0 (17.2) 70.8 (70.8) 66.6 (75.0) 22 May 25 May 27 May 3 June 13.1 (2.5) 28 May 29 May 1 June TM-1 TM-2 TM-3 55.2 (62.8) 32.9 (29.1) ABE-1 ABE-2 ABE-3 ABE-4 20 20 20 20 45.79′ 45.80′ 45.80′ 45.80’ S, S, S, S, 176 176 176 176 11.47′ 11.48′ 11.48′ 11.48′ W W W W Chimney wall Diffuse flow Diffuse flow Diffuse flow 2.5 (45.0) 40.9 (47.0) 9.2 (60.2) 239.2 (281) 38.8 (356) 2.5 (91.1) 2.5 (71.0) 11.3 (8.9) 16.9 (14.7) 5.1 (34.6) 10.9 (27.3) 26.5 (15.4) 25.1 (21.4) 7.1 (128) 7.9 (49.5) 4 31 35 15 27 23 65 8 42 9 15 74 45 47 22 114 288 21 59.36′ S, 176 34.10′ W Chimney wall 21 59.37′ S, 176 34.11′ W Diffuse flow 21 59.35′ S, 176 34.09′ W Diffuse flow 0 6 6 0 0 2 2 0 4 0 1 5 12 0 4 16 29

!

Beinart et al. www.pnas.org/cgi/content/short/1202690109

Table S1. Contextual information regarding the sample collection sites, including dive numbers, number of individuals (Alv), coordinates, habitat type, and oxygen, temperature, and sulfide from cyclic voltammetry scans

Vent field

98

Kilo Moana J2-J2-421 J2-J2-433 Total Kilo Moana Tow Cam J2-422 J2-432* J2-432* Total Tow Cam ABE J2-423 J2-425*,† J2-426* J2-431*,† Total ABE Tu’i Malila J2-428 J2-428 J2-430 Total Tu’i Malila Total

*These collections were <10 m from the other marked collections within the same vent field but are ecologically distinct habitats. † These collections are from the same site.

3 of 5

!

Table S2. Alviniconcha host mitochondrial CO1 haplotypes, with number of individuals according to vent field
No. of individuals Haplotype Host type I 3 6 8 9 10 13 16 17 22 23* 24 27 28 39 40 41 49 51 53 55 Host type II 4 7 15 18 20 21 31 32 37 38 42 44 48 56* Host type III 1 2 5 11 12 14 19 25 26 29 30 33 34 35 36 43 45 46 47 50* 52 54 Accession No. JQ624364 JQ624367 JQ624369 JQ624370 JQ624371 JQ624374 JQ624377 JQ624378 JQ624383 AB235211 JQ624384 JQ624387 JQ624388 JQ624397 JQ624398 JQ624399 JQ624407 JQ624408 JQ624410 JQ624412 JQ624365 JQ624368 JQ624376 JQ624379 JQ624381 JQ624382 JN402310 JQ624391 JQ624395 JQ624396 JQ624400 JQ624402 JQ624406 AB235212 JQ624362 JQ624363 JQ624366 JQ624372 JQ624373 JQ624375 JQ624380 JQ624385 JQ624386 JQ624389 JQ624390 JQ624392 JQ624393 JN402311 JQ624394 JQ624401 JQ624403 JQ624404 JQ624405 AB235215 JQ624409 JQ624411 Kilo Moana Tow Cam ABE 1 1 2 1 1 1 5 11 1 24 2 4 13 1 1 1 5 Tu’i Malila Total 1 1 2 1 1 1 7 16 1 42 1 1 11 1 11 2 1 1 1 1 1 1 1 1 1 1 16 1 1 1 12 1 1 54 1 1 6 2 1 1 1 1 1 6 1 1 1 8 1 1 1 2 1 2 1 36

1 1 4 1

5 1

5 5 2 1 1

1 1 1 1 1 1 1 7 8 1 1 1 1 1 5 1 14 6 1 36 1

4 1 1 6 2 1 1 1 1 1 6 1 1 1 8 1 1 1 2 1 2 1 35

1

*Haplotypes found in previous studies as well as here.

Beinart et al. www.pnas.org/cgi/content/short/1202690109

4 of 5

! !
99

!

Table S3. Carbon-stable isotopic values of gill tissues according to dominant symbiont phylotype
Vent field Kilo Moana Tow Cam ABE Tu’i Malila Symbiont phylotype ε ε γ-1 ε γ-1 γ-1 γ-Lau γ-Both n 7 5 2 5 9 10 25 8 δ13C average ± SD −11.5 ± 0.2 −11.4 ± 0.5 −29.2 −11.8 ± 0.5 −29.5 ± 1.6 −28.9 ± 1.1 −26.2 ± 3.2 −26.8 ± 1.9

ε, ε-proteobacteria; γ-1, γ-proteobacteria type 1; γ-Lau, γ-proteobacteria type Lau; γ-Both, snails that have γ-1 and γ-Lau in approximately equal proportions.

Table S4. qPCR primer sets designed to target Alviniconcha symbiont phylotypes
Symbiont genotype γ-1 γ-Lau ε Forward Reverse Forward Reverse Forward Reverse Primers (5′–3′) ACGGAATAAAGGTGGCCTCTGGTT TGGATCGTCGCCTTGGTAGACCT CCTTCGGGAGTGAGTAGAGTG TACTGGGCAGATTTCCACGCGTTA AACGCCGCGTGGAGGATGAC TACGTGTCCTTTACGCCCAGTGAT Amplicon length (bp) 108 58 163 Primers (nM) 300 300 100 Average % efficiency ± SD 90 ± 0.06 94 ± 0.04 90 ± 0.06 Average R2 ± SD 0.996 ± 0.002 0.996 ± 0.003 0.982 ± 0.016

Average efficiencies and R2 for plasmid standard curves are shown. Symbiont phylotypes: ε, ε-proteobacteria; γ-1, γ-proteobacteria type 1; γ-Lau, γ-proteobacteria type Lau.

Table S5.
Individual 1

Intragill comparison of symbiont proportions
Vent field (dive) Tow Cam (J2-432) Gill section A B C A B C A B C A B C A B C A B C % γ-1 0.00 0.00 0.00 INH 0.00 0.00 INH 0.00 0.00 99.99 99.92 99.84 99.96 99.92 99.97 99.99 99.87 99.87 % γ-Lau 0.00 0.00 0.00 INH 0.00 0.00 INH 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.05 0.00 %ε 100.00 100.00 99.99 INH 100.00 100.00 INH 100.00 100.00 0.01 0.08 0.16 0.04 0.08 0.03 0.01 0.08 0.13

2

Tow Cam (J2-432)

3

Tow Cam (J2-432)

4

ABE (J2-435)*

5

ABE (J2-435)*

6

ABE (J2-435)*

A, adjacent to pallial margin; B, middle gill; C, posterior gill end; J2-435 from cruise TM-235, June–July 2009; INH, amplification was inhibited, thus sample was not measurable; symbiont phylotypes: ε, ε-proteobacteria; γ-1, γ-proteobacteria type 1; γ-Lau, γ-proteobacteria type Lau.

Beinart et al. www.pnas.org/cgi/content/short/1202690109

5 of 5

!

!

100

Appendix 2 Chapter 3 Supplemental Material

Supplementary Methods: In situ homogenization To effectively preserve holobiont RNA in situ, we designed a combined sample container/homogenizer capable of operation at depth, hereafter referred to as the In-Situ Mussel And Snail Homogenizer (ISMASH; Fig. 1). ISMASH consists of a stainless steel cylinder of approximately 1L volume, wherein the cylinder bottom contains a rotating blade assembly (Waring Inc.) and preservative inlet. One-half inch diameter nylon rods are affixed to the interior sides of the blender to disrupt fluid flow and improve blending performance. The rotating blade assembly is coupled via a custom-machined coupling to a hydraulic motor (.218 cubic inch displacement gerotor, max 5000 RPM / 12 HP power / 35 in-lbs torque; Model # MGG20010, Parker Hannifin, Youngstown, OH). Based on approximate hydraulic flow rates from the Jason 2 submersible and motor manufacturer data, we estimate actual blade rotation speeds of approximately 20003000 RPM. The top of the blender chamber is sealed by a detachable lid with an o-ring that seals against the upper flange of the cylinder. The lid is held in place by six pairs of neodymium magnets, one set of which is mounted on the lid while the other set is affixed to the cylinder flange. The lid also includes a polypropylene rope for ease of removal and emplacement by the robotically operated vehicle, as well as a one-way plastic diaphragm-style check valve with a low cracking pressure. The preservative inlet also includes a one-way, low cracking-pressure spring-operated check valve to isolate blender contents, and a compression fitting for connection to the preservative reservoir, a plastic collapsible 10 L container. For sample collection, the collapsible container is cleaned and filled with the preservative RNALater™ (Ambion Inc), which has been dyed using FD&C red no. 5 food coloring. The preservative container is then affixed to the robotically operated vehicle (ROV) and connected to the inlet at the base of the blender body. Individual samples are collected using the ROV’s manipulators, deposited in the cylinder, and the magnetically latched lid is closed by the ROV operator. RNALater™ is pumped into the cylinder by compressing the collapsible container in situ using the ROV manipulator, displacing the less-dense seawater through the lid’s check valve. Once the cylinder is flooded (as indicated by the color and visible differences in density and refractive index of the effluent emitted from the lid check valve), the hydraulic motor is actuated to homogenize the sample. The time from collection of the sample to homogenization is typically around seven minutes. Upon completion, the sample is left in the chamber until recovery at the surface. One-way check valves on the inlet and outlet, and the robust latching of the lid to the cylinder, ensure that the sample has minimal contact with the surrounding seawater. At the surface, samples are carefully transferred to sterile glass jars and incubated per the manufacturer’s instructions prior to freezing for shipment to the laboratory.

102

Supplementary Figures:

Figure S1: Map of the Eastern Lau Spreading Center, with four vent fields from which Alviniconcha were sampled with the ISMASH. Dive numbers associated with each sample are shown next to each vent field.

103

Figure S2: Agilent Bioanalyzer traces of total ISMASH RNA from each sample. Peaks are labeled for bacterial (symbiont) 16S and 23S rRNA and snail host 18S rRNA. In the snails, as with most protostomes, the 28S RNA is post-transcriptionally fragmented into two large pieces that are attached in vivo via hydrogen bonds. During extraction, most of these separate and migrate with the 18S rRNA.

104

Supplementary Table:

Table S1: Normalized read counts for pathways and gene categories discussed here. Annotation was performed in MGRAST using SEED/Subsystems unless indicated by an asterisk (*), which designates MGRAST IMG annotation. † indicates that one or more (non-normalized) reads for this gene was assigned to the non-dominant symbiont class (e.g., assigned to ε-proteobacteria in a γ-dominated metatranscriptome) in MEGAN. “% reads” = the percentage of reads that were allied to the non-dominant symbiont class in that category.
KM MGRAST SEED/Subsystems Sulfur Oxidation % reads Sox multienzyme complex Sulfur oxidation protein SoxA Sulfur oxidation protein SoxB Sulfur oxidation molybdopterin C protein SoxC Sulfite dehydrogenase cytochrome subunit SoxD Sulfur oxidation protein SoxX Sulfur oxidation protein SoxY Sulfur oxidation protein SoxZ Reverse DSR Sulfite reductase alpha subunit DsrA 1.8.99.1 Sulfite reductase beta subunit DsrB 1.8.99.1 Sulfite reductase, dissimilatory-type gamma subunit DsrC 1.8.99.3 DsrE* DsrF* DsrH* Sulfite reduction-associated complex DsrMKJOP multiheme protein DsrJ (=HmeF) Sulfite reduction-associated complex DsrMKJOP protein DsrK (=HmeD) Similar to glutamate synthase [NADPH] small chain, clustered with sulfite reductase DsrL Sulfite reduction-associated complex DsrMKJOP protein DsrM (= HmeC) Sulfite reduction-associated complex DsrMKJOP iron-sulfur protein DsrO (=HmeA) Sulfite reduction-associated complex DsrMKJOP protein DsrP (= HmeB) DsrR* EC # TC ABE TM

ε
0.0

ε
0.0

γ
1.9

γ
0.0

1 7 104 6 0 3 2

4 10 74 15 16 18 15

1 † 1 0 0 9 3 3

†

0 0 0 0 9 2 1

0 1 0 0 0 0 0 0 0 0 0 0 0

0 0 0 0 0 0 0 0 0 0 0 0 0

41 47 34 23 2 8 0 25 26 10 4 6 0

†

16 20 37 18 0 6 1 20 28 19 3 13 2

105

Indirect sulfite oxidation pathway Sulfate adenylyltransferase, dissimilatory-type Sat Adenylylsulfate reductase alpha-subunit AprA Adenylylsulfate reductase beta-subunit AprB Adenylylsulfate reductase membrane anchor

2.7.7.4 1.8.99.2 1.8.99.2 1.8.99.2

6 0 0 0

1 0 0 0

7 54 5 12

†

1 12 0 3

Sulfide dehydrogenase Sulfide dehydrogenase [flavocytochrome C] flavoprotein chain precursor FccB 1.8.2.sulfide dehydrogenase, flavoprotein subunit FccB 1.8.2.Sulfide quinone (oxido)reductase sulfide qunione (oxido)reductase Sqr Hydrogen oxidation % reads Hydrogenases Uptake hydrogenase cytochrome Uptake hydrogenase large subunit Uptake hydrogenase small subunit or precursor Hydrogen-sensing hydrogenase large subunit Hydrogen-sensing hydrogenase small subunit Dissimilatory nitrogen metabolism % reads

0 0

0 0

1 1

4 0

41 0.0

66 0.0

22

†

55 0.0

0.0

1.12.99.6 1.12.99.6 1.12.99.6

13 19 11 0 0 0.0

10 16 12 1 0 0.0

1 1 1 3 1 2.5

0 0 2 2 0 0.0

Nitrate respiration Assimilatory nitrate reductase large subunit NapA 1.7.99.4 Periplasmic nitrate reductase precursor NapA 1.7.99.4 Nitrate reductase cytochrome c550-type subunit NapB Cytochrome c-type protein NapC Periplasmic nitrate reductase component NapD Ferredoxin-type protein NapF (periplasmic nitrate reductase) Ferredoxin-type protein NapG (periplasmic nitrate reductase) Polyferredoxin NapH (periplasmic nitrate reductase) Periplasmic nitrate reductase component NapL Denitrification Cytochrome cd1 nitrite reductase NirS Nitric-oxide reductase subunit B NorB Nitric-oxide reductase subunit C NorC Nitric oxide reductase activation protein NorE Nitric oxide reductase activation protein NorD Nitric oxide reductase activation protein NorQ Nitrous-oxide reductase NosZ Nitrous oxide reductase maturation protein NosD Nitrous oxide reductase maturation protein NosF (ATPase)

19 83 58 0 1 0 19 49 0

17 52 48 0 0 0 15 39 0

9 13 0 8 0 1 10 19 0

†

10 10 0 7 0 1 6 9 0

1.7.2.1 1.7.99.7 1.7.99.7

1.7.99.6

85 57 12 0 0 0 50 2 0

69 33 12 0 0 0 28 3 2

2 23 6 1 6 4 7 2 0

†

3 10 3 2 3 2 10 2 1

106

Nitrous oxide reductase maturation transmembrane protein NosY Nitrous oxide reductase maturation protein, outer-membrane lipoprotein NosL Nitrogen assimilation % reads Assimilatory nitrite reduction Nitrate/nitrite transporter NarK Nitrite reductase [NAD(P)H] large subunit NirB Nitrite reductase [NAD(P)H] small subunit NirD Ferredoxin--nitrite reductase NirA Ammonia assimilation Ammonium transporter Glutamine synthetase type I Glutamate synthase [NADPH] large chain Glutamate synthase [NADPH] small chain Carbon Fixation Calvin-Benson Cycle Triosephosphate isomerase Transketolase Ribulose-phosphate 3-epimerase Ribulose bisphosphate carboxylase Ribose 5-phosphate isomerase B Ribose 5-phosphate isomerase A Phosphoribulokinase Phosphoglycerate kinase NADPH-dependent glyceraldehyde-3-phosphate dehydrogenase NAD-dependent glyceraldehyde-3-phosphate dehydrogenase Fructose-bisphosphate aldolase Class II Fructose-bisphosphate aldolase class I Fructose-1,6-bisphosphatase, type 1 Fructose-1,6-bisphosphatase, GlpX type 1.7.1.4 1.7.1.4 1.7.7.1

1 0 0.0

3 0 0.0

1 0 0.0

5 0 0.0

3 0 0 1

17 0 0 4

3 14 1 0

1 2 2 0

6.3.1.2 1.4.1.13 1.4.1.13

17 51 16 18

49 57 23 19

15 10 50 4

21 9 21 13

5.3.1.1 2.2.1.1 5.1.3.1 4.1.1.39 5.3.1.6 5.3.1.6 2.7.1.19 2.7.2.3 1.2.1.13 1.2.1.12 4.1.2.13 4.1.2.13 3.1.3.11 3.1.3.11

1 10 1 0 2 0 0 7 0 8 5 1 2 2

1 15 0 0 7 0 0 12 0 5 4 0 6 0

12 56 8 16 0 3 5 19 14 4 19 0 0 0

10 27 8 6 0 6 8 15 8 8 10 0 0 1

Reverse TCA Cycle Pyruvate:ferredoxin oxidoreductase, alpha subunit Pyruvate:ferredoxin oxidoreductase, beta subunit Pyruvate:ferredoxin oxidoreductase, gamma subunit Pyruvate:ferredoxin oxidoreductase, delta subunit Citrate lyase, subunit 1 Citrate lyase, subunit 2 2-oxoglutarate oxidoreductase, alpha subunit 2-oxoglutarate oxidoreductase, beta subunit 2-oxoglutarate oxidoreductase, gamma subunit 2-oxoglutarate oxidoreductase, delta subunit

1.2.7.1 1.2.7.1 1.2.7.1 1.2.7.1 2.3.3.8 2.3.3.8 1.2.7.3 1.2.7.3 1.2.7.3 1.2.7.3

24 28 5 2 15 38 30 6 19 33

15 22 8 1 7 49 35 3 21 24

0 0 0 0 0 1 1 0 1 1

0 0 0 0 0 0 0 0 0 0

107

Flagellum Flagellar L-ring protein FlgH Flagellar M-ring protein FliF Flagellar P-ring protein FlgI Flagellar basal-body rod modification protein FlgD Flagellar basal-body rod protein FlgB Flagellar basal-body rod protein FlgC Flagellar basal-body rod protein FlgF Flagellar basal-body rod protein FlgG Flagellar biosynthesis protein FlhA Flagellar biosynthesis protein FlhB Flagellar biosynthesis protein FlhF Flagellar biosynthesis protein FliP Flagellar biosynthesis protein FliQ Flagellar biosynthesis protein FliR Flagellar biosynthesis protein FliS Flagellar hook protein FlgE Flagellar hook-associated protein FlgK Flagellar hook-associated protein FlgL Flagellar hook-associated protein FliD Flagellar hook-basal body complex protein FliE Flagellar hook-length control protein FliK Flagellar motor rotation protein MotA Flagellar motor rotation protein MotB Flagellar motor switch protein FliG Flagellar motor switch protein FliM Flagellar motor switch protein FliN Flagellar protein FlbB Flagellar regulatory protein FleQ Flagellar synthesis regulator FleN Flagellin protein FlaA Flagellin protein FlaB Flagellum-specific ATP synthase FliI Sulfur reduction Polysulphide reductase

3 8 0 1 4 2 1 4 2 3 1 1 0 1 1 5 6 0 2 6 29 0 1 4 4 10 1 0 2 31 6 1 0

1 8 7 5 2 4 0 3 5 2 4 1 1 1 1 11 4 0 0 4 47 1 3 3 2 7 0 0 1 32 0 2 0

0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 0 0 0 1 1 0 0 0 0 1 1 0 0 0 1

0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 0 1 1 0 3

108

Appendix 3 Chapter 4 Supplemental Material

Table S4.1: Input water conditions for all experiments and treatments. Mean (min, max) sulfide concentrations as determined via a colorimetric assay as applied to discrete water samples of input water; partial pressure of O2 and calculated concentration of O2 in input water; mean (min, max); and atom percent of 13C in dissolved inorganic carbon (DIC).

Incubation No sulfur Sulfide Thiosufate Sulfide treatment Thiosulfate treatment

Mean [sulfide] (min, max) (μM) NA 105 (57, 137) 0 (0,0) 388 (338,459) 0 (0,0)

pO2 (%) 50 27.5 54.8 54.5 52.3

[O2] (μM)* 562 310 618 615 590

Mean A% DIC (min, max) 5.08 (4.22, 5.59) 5.44 (5.25, 5.75) 4.83 (3.70, 5.63) 6.45 (6.28, 6.62) 3.38 (2.89, 3.74)

*Concentration of O2 calculated based on concentration of 100% pO2 in seawater at 20°C, 35 psu (Weiss et al., 1970)

Table S4.2: The average (± S.D.) of the stable isotopic composition of experimental foot and natural tissue expressed as δ13C (‰).

Experimental Foot Alviniconcha I. nautilei B. brevior
a b

Natural -27.6 ± 2.30a -28.5b -30.6 ± 2.52c

-27.0 ± 1.16 -28.0 ± 0.95 -28.1 ± 1.93

gill tissue values, Lau Basin, from Beinart et al., 2012 gill tissue value, Lau Basin from Suzuki et al., 2006 c foot tissue values, North Fiji Basin from Dubilier et al., 1998

!

110

Table S4.3: Proportions of symbiont phylotypes associating with Alviniconcha as assessed via quantitative PCR.

Experiment/Treatment No sulfur

Individual 1 2 3 4 5 1 2 3 4 5 1 2 3 1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 6 7 8

%γ-1 100 99 100 3 3 100 100 93 99 96 100 99 100 0 99 99 100 100 0 0 0 0 0 100 100 100 100 99 100 100 100

%γ-Lau 0 1 0 97 96 0 0 7 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

%ε 0 0 0 0 0 0 0 1 0 4 0 1 0 100 1 1 0 0 100 100 100 100 100 0 0 0 0 1 0 0 0

Sulfide

Thiosulfate

Sulfide treatment

Thiosulfate treatment

!

111

450! 400! 350! Colorimetric (µM) 300! 250! 200! 150! 100! 50! 0! "50! 0! 200! 400! y"="0.1427x"+"0.0285" 600! 800! 1000! 1200! 1400! y"="0.3297x"+"0.0659"

Voltammetric microelectrode (µM)

Figure S4.1: Two-point calibration of voltammetric microelectrodes with the average [sulfide] as determined via a colorimetric assay applied to discrete water samples from input water (exposure treatment; blue) or control effluent (rate experiment; red).

!

12! 10! 8! 6! 4! 2! 0! 0! 10! 20! 30! 40! 50! 60! y = 0.1661x + 1.2056 R² = 0.87251 y = 0.4256x - 1.1524 R² = 0.85497

Gill weight (g)

y = 0.173x + 1.4095 R² = 0.89354

Alviniconcha Ifremeria Bathymodiolus

Body weight (g)
Figure S4.2: Linear regression of gill weight to body weight for each of the three mollusc genera.

!

! ! !
112

Figure S4.3 Stable carbon isotopic composition of Alviniconcha (△), B. brevior (☐), and I. nautilei (◇) gill tissue after rate experiments and exposure treatments.

!

! Supplemental References Beinart, R.A. et al., 2012. Evidence for the role of endosymbionts in regional-scale habitat partitioning by hydrothermal vent symbioses. Proceedings of the National Academy of Sciences. Online Only. Dubilier, N., Windoffer, R. & Giere, O., 1998. Ultrastructure and stable carbon isotope composition of the hydrothermal vent mussels Bathymodiolus brevior and B. sp. affinis brevior from the North Fiji Basin, western Pacific. Marine Ecology Progress Series, 165, pp.187– 193. Suzuki, Y. et al., 2006. Host-symbiont relationships in hydrothermal vent gastropods of the genus Alviniconcha from the Southwest Pacific. Applied and Environmental Microbiology, 72(2), pp.1388–1393. Weiss, R.F., 1970. The solubility of nitrogen, oxygen and argon in water and seawater. Deep Sea Research and Oceanographic Abstracts. 17(4), pp.721-735.

!

!

113

Appendix 4 Chapter 5 Supplemental Material

Supporting Table 5.1: Number of Alviniconcha individuals in which AOP was detected/not detected via 16S rRNA gene qPCR according to majority symbiont class and host type. Host type Majority symbiont I Undetermined II III All 5/97 ε 2/4 3/85 NA 0/8 173/8 11/0 γ 88/5 NA 74/3 90/9 3/85 74/3 11/8 All 178/105

115

Supporting Table 5.2: Proportion of AOP 16S rRNA genes, relative to the 16S rRNA genes of the symbionts, in individuals according to their majority symbiont class and host type. Percentages are shown as median maximum). Host type Majority symbiont I Undetermined II III All 0 (0, 7.5) ε 0 (0, 7.5) 0 (0, 2.5) NA 0 (0,0) 1.83 (0.09, 21.6) 1.3 (0, 36) γ 1.6 (0, 36) NA 1.2 (0,15) 1.5 (0, 36) 0 (0, 2.5) 1.2 (0,15) NA All 0.53 (0, 36)

Alviniconcha (minimum,

116

!

Supporting Table 5.3: Proportion of AOP 16S rRNA genes, relative to the 16S rRNA genes of the symbionts, in Alviniconcha individuals at the four vent fields at the ELSC, shown north to south in descending order. Percentages are shown as median (minimum, maximum). Dominant symbiont phylotypes and host types for the Alviniconcha communities inhabiting each vent field are indicated (Beinart et al., 2012). Vent field %AOP Dominant symbiont Dominant host ε Kilo Moana 0 (0,0) II ε Tow Cam 0 (0,35) II γ-1 ABE 1.5 (0,36) I γ-1, γ-Lau Tu’i Malila 1.3 (0,22) I, III

117

!

Supporting References: Beinart,R.A. et al. (2012) Evidence for the role of endosymbionts in regional-scale habitat partitioning by hydrothermal vent symbioses. Proceedings of the National Academy of Sciences. Zielinski,F.U. et al. (2009) Widespread occurrence of an intranuclear bacterial parasite in vent and seep bathymodiolin mussels. Environ. Microbiol. 11: 1150–1167.

!

!

118